Mutagenetix > Incidental Mutations

Incidental Mutation 'R7194:Muc16'

559796

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.144) question?

Stock #

R7194 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 18674454 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 26 (L26S)

Ref Sequence

ENSEMBL: ENSMUSP00000147104 (fasta)

Predicted Effect

unknown
Transcript: ENSMUST00000208663
AA Change: L26S

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	T	G	6: 96,164,775	E429D	probably benign	Het
4930402H24Rik	C	A	2: 130,806,788	R258L	unknown	Het
Aadat	A	G	8: 60,526,622	I173V	probably benign	Het
Abi3bp	C	T	16: 56,562,371	R115C	probably damaging	Het
Adam18	A	G	8: 24,651,852	S234P	possibly damaging	Het
Adam20	A	G	8: 40,796,412	R520G	probably benign	Het
Angel2	C	G	1: 190,944,997	T514R	probably damaging	Het
Ankar	A	T	1: 72,659,033	I954N	probably benign	Het
Ankrd7	A	T	6: 18,879,343	Y262F	probably benign	Het
Ano8	C	A	8: 71,482,363	L398F	possibly damaging	Het
App	C	T	16: 85,025,431	V356I	probably benign	Het
Atp1a2	C	A	1: 172,280,627	E636*	probably null	Het
Cckbr	G	A	7: 105,435,345	E429K	possibly damaging	Het
Cfi	T	G	3: 129,855,059	S197R	probably damaging	Het
Chn2	A	G	6: 54,286,177		probably null	Het
Col3a1	C	A	1: 45,331,700	A405D	unknown	Het
Colec12	A	T	18: 9,848,248	N142I	probably benign	Het
Copa	T	C	1: 172,119,944	L1109P	probably damaging	Het
Cpeb3	T	A	19: 37,174,752	M75L	probably benign	Het
Cyp2d11	T	C	15: 82,391,768	Y204C	probably benign	Het
Defa17	A	G	8: 21,656,597	T80A	probably benign	Het
Dppa5a	C	T	9: 78,367,720		probably null	Het
Fat4	G	T	3: 38,888,884	S642I	probably damaging	Het
Fat4	T	A	3: 38,983,895	C3899S	probably damaging	Het
Fn1	A	G	1: 71,602,323	V1869A	probably damaging	Het
Gm10308	A	T	17: 91,088,961	I104L	unknown	Het
Gm15448	A	G	7: 3,824,793	W122R		Het
Gpr139	C	T	7: 119,144,673	A230T	possibly damaging	Het
Grm8	T	C	6: 27,618,487	N452S	probably benign	Het
Hmox1	T	C	8: 75,096,923	V73A	probably benign	Het
Hspa4	A	G	11: 53,265,938	F641L	probably damaging	Het
Ifi207	T	G	1: 173,729,924	H416P	possibly damaging	Het
Igkv10-96	G	T	6: 68,632,044	T89K	possibly damaging	Het
Kmt2d	A	C	15: 98,843,833	V4482G	unknown	Het
Krt28	T	A	11: 99,374,404	K146*	probably null	Het
Krt82	T	C	15: 101,542,756	N406S	probably damaging	Het
Marveld3	A	T	8: 109,959,845		probably null	Het
Mllt6	C	T	11: 97,673,568	S370L	probably benign	Het
Mup12	T	A	4: 60,740,735	E48V	probably benign	Het
Myh1	G	A	11: 67,211,357	V825I	probably benign	Het
Nipal3	G	A	4: 135,474,421	T152I	probably benign	Het
Nrg3	A	T	14: 39,472,478	M108K	probably benign	Het
Olfr961	G	A	9: 39,647,091	V122I	probably benign	Het
Oog3	A	T	4: 144,162,599	I3N	probably damaging	Het
Pkhd1l1	T	C	15: 44,529,116	C1616R	probably damaging	Het
Ppa2	T	A	3: 133,348,192		probably null	Het
Ppfibp2	T	A	7: 107,722,980		probably null	Het
Ppp4c	T	C	7: 126,786,481	N229D	probably damaging	Het
Ptpn9	T	C	9: 57,022,286	F96L	probably damaging	Het
Pygl	A	G	12: 70,194,320	V742A	probably benign	Het
Ranbp2	A	G	10: 58,476,769	T1104A	probably benign	Het
Rasal1	G	A	5: 120,675,492	A644T	probably benign	Het
Rcor3	T	A	1: 192,125,961	T139S	possibly damaging	Het
Rfx5	T	A	3: 94,955,143	I37N	probably damaging	Het
Rnf112	C	T	11: 61,450,857	G374R	probably damaging	Het
Rrp12	T	C	19: 41,871,540	I1034V	probably benign	Het
Sacs	T	A	14: 61,210,089	Y3195N	possibly damaging	Het
Scn4a	A	G	11: 106,324,236	I1243T	probably benign	Het
Sirt7	A	T	11: 120,618,973	C362S	probably benign	Het
Slc17a6	T	A	7: 51,626,892	S130T	probably damaging	Het
Snrnp48	A	C	13: 38,209,899	Y60S	probably damaging	Het
Syne1	T	C	10: 5,110,859	E7260G	probably damaging	Het
Trbv15	C	T	6: 41,141,595	T95I	probably benign	Het
Trip12	A	T	1: 84,794,222	N68K	probably benign	Het
Ugcg	A	G	4: 59,213,210	Y132C	probably damaging	Het
Usp9y	A	T	Y: 1,304,672	C2391S	probably damaging	Het
Vmn1r103	C	A	7: 20,510,513	V8L	probably benign	Het
Vmn2r15	T	A	5: 109,292,783	N403I	probably damaging	Het
Zbtb11	T	C	16: 56,007,188	S1006P	probably damaging	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	splice site	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	splice site	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7666:Muc16	UTSW	9	18558427	missense	probably damaging	1.00
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown
R7743:Muc16	UTSW	9	18657477	missense	unknown
R7744:Muc16	UTSW	9	18585096	critical splice acceptor site	probably null
R7761:Muc16	UTSW	9	18580574	missense	probably damaging	1.00
R7769:Muc16	UTSW	9	18660507	missense	unknown
R7805:Muc16	UTSW	9	18638493	missense	possibly damaging	0.94
R7827:Muc16	UTSW	9	18595223	missense	possibly damaging	0.83
R7845:Muc16	UTSW	9	18640773	missense	probably benign	0.01
R7849:Muc16	UTSW	9	18640505	missense	probably benign	0.01
R7884:Muc16	UTSW	9	18642694	missense	unknown
R7885:Muc16	UTSW	9	18639464	missense	probably benign	0.10
R7886:Muc16	UTSW	9	18585982	missense	probably benign	0.03
R7899:Muc16	UTSW	9	18640697	missense	probably benign	0.01
R7904:Muc16	UTSW	9	18655650	missense	unknown
R7921:Muc16	UTSW	9	18659318	missense	unknown
R7922:Muc16	UTSW	9	18584825	missense	probably benign	0.16
R7948:Muc16	UTSW	9	18642490	missense	unknown
R7957:Muc16	UTSW	9	18643471	missense	unknown
R7972:Muc16	UTSW	9	18645764	nonsense	probably null
R7992:Muc16	UTSW	9	18656429	missense	unknown
R7998:Muc16	UTSW	9	18639892	missense	probably benign	0.04
R8014:Muc16	UTSW	9	18654875	missense	unknown
R8033:Muc16	UTSW	9	18636606	missense	probably benign	0.26
R8052:Muc16	UTSW	9	18659051	missense	unknown
R8058:Muc16	UTSW	9	18660002	nonsense	probably null
R8088:Muc16	UTSW	9	18519300	nonsense	probably null
R8095:Muc16	UTSW	9	18584830	nonsense	probably null
R8111:Muc16	UTSW	9	18592629	missense	possibly damaging	0.55
R8116:Muc16	UTSW	9	18658737	missense	unknown
R8117:Muc16	UTSW	9	18508910	nonsense	probably null
R8137:Muc16	UTSW	9	18645676	missense	unknown
R8196:Muc16	UTSW	9	18645334	missense	unknown
R8218:Muc16	UTSW	9	18637019	missense	possibly damaging	0.48
R8285:Muc16	UTSW	9	18642977	missense	unknown
R8313:Muc16	UTSW	9	18525147	missense	possibly damaging	0.85
R8317:Muc16	UTSW	9	18658043	missense	unknown
R8342:Muc16	UTSW	9	18658685	missense	unknown
R8351:Muc16	UTSW	9	18659885	missense	unknown
R8356:Muc16	UTSW	9	18658778	missense	unknown
R8360:Muc16	UTSW	9	18525258	missense	probably benign	0.01
R8418:Muc16	UTSW	9	18519630	missense	possibly damaging	0.94
R8420:Muc16	UTSW	9	18537511	missense	probably damaging	0.99
R8437:Muc16	UTSW	9	18657924	missense	unknown
R8463:Muc16	UTSW	9	18659139	missense	unknown
R8466:Muc16	UTSW	9	18643148	missense	unknown
R8512:Muc16	UTSW	9	18638192	missense	probably benign	0.01
R8518:Muc16	UTSW	9	18519631	missense	probably benign	0.12
R8556:Muc16	UTSW	9	18640937	missense	probably benign	0.01
Z1177:Muc16	UTSW	9	18537571	missense	probably benign	0.26
Z1177:Muc16	UTSW	9	18657861	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCATAAGATGTCAGGGACTTAGG -3'
(R):5'- CCATCAAGGTGTGTTCTCAAC -3'

Sequencing Primer
(F):5'- GATGTCAGGGACTTAGGTATACC -3'
(R):5'- GTTCTCAACACCCTCCCTGAAG -3'

Posted On

2019-06-26