Mutagenetix > Incidental Mutation

Incidental Mutation 'R0593:Cops6'

56057

Institutional Source

Beutler Lab

Gene Symbol

Cops6

Ensembl Gene

ENSMUSG00000019494

Gene Name

COP9 signalosome subunit 6

Synonyms

COP9 complex S6, VIP/MOV34, Sgn3

MMRRC Submission

038783-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0593 (G1)

Quality Score

202

Status

Validated

Chromosome

Chromosomal Location

138159364-138162246 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 138161842 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 96 (T96A)

Ref Sequence

ENSEMBL: ENSMUSP00000121554 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000505] [ENSMUST00000019638] [ENSMUST00000110951] [ENSMUST00000132639] [ENSMUST00000148879] [ENSMUST00000153867]

AlphaFold

O88545

Predicted Effect

probably benign
Transcript: ENSMUST00000000505

SMART Domains

Protein: ENSMUSP00000000505
Gene: ENSMUSG00000029730

Domain	Start	End	E-Value	Type
Blast:MCM	48	132	1e-41	BLAST
MCM	145	642	N/A	SMART
AAA	373	526	2.9e-4	SMART
Blast:MCM	658	719	1e-32	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000019638
AA Change: T269A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000019638
Gene: ENSMUSG00000019494
AA Change: T269A

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
JAB_MPN	37	170	9.73e-35	SMART
Pfam:MitMem_reg	191	304	1.1e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083580

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083593

Predicted Effect

probably benign
Transcript: ENSMUST00000110951
AA Change: T242A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000106576
Gene: ENSMUSG00000019494
AA Change: T242A

Domain	Start	End	E-Value	Type
JAB_MPN	10	143	9.73e-35	SMART
Pfam:MitMem_reg	163	279	2.6e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125316

Predicted Effect

probably benign
Transcript: ENSMUST00000132639
AA Change: T96A

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000121554
Gene: ENSMUSG00000019494
AA Change: T96A

Domain	Start	End	E-Value	Type
Pfam:MitMem_reg	17	112	3.6e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127881

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154867

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142254

Predicted Effect

probably benign
Transcript: ENSMUST00000148879

SMART Domains

Protein: ENSMUSP00000116131
Gene: ENSMUSG00000029730

Domain	Start	End	E-Value	Type
Blast:MCM	48	132	6e-44	BLAST
MCM	145	389	1.77e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000153867

SMART Domains

Protein: ENSMUSP00000121566
Gene: ENSMUSG00000029730

Domain	Start	End	E-Value	Type
Pfam:MCM_N	1	58	9.5e-10	PFAM

Meta Mutation Damage Score

0.0624

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 96.9%
20x: 93.4%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the eight subunits of COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. This protein belongs to translation initiation factor 3 (eIF3) superfamily. It is involved in the regulation of cell cycle and likely to be a cellular cofactor for HIV-1 accessory gene product Vpr. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele or a transgenic gene disruption exhibit embryonic lethality. Mice heterozygous for a gene trap allele exhibit increased sensitivity to irradiation and decreased incidence of ionizing radiation-induced tumors. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Gene trapped(15)

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	T	C	11: 109,958,925 (GRCm39)	D733G	probably damaging	Het
Acmsd	T	C	1: 127,666,340 (GRCm39)		probably benign	Het
Adam34	T	C	8: 44,104,724 (GRCm39)	Y307C	possibly damaging	Het
Alox12e	A	G	11: 70,211,723 (GRCm39)		probably benign	Het
Ankrd50	C	A	3: 38,537,156 (GRCm39)	G29*	probably null	Het
Arhgap17	T	C	7: 122,885,966 (GRCm39)		probably benign	Het
Asah1	A	G	8: 41,802,619 (GRCm39)	M141T	probably benign	Het
Atg2a	GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	19: 6,295,037 (GRCm39)		probably benign	Het
Bsn	A	T	9: 107,987,505 (GRCm39)	I2749N	unknown	Het
Cds2	G	A	2: 132,139,296 (GRCm39)		probably benign	Het
Ckmt2	A	G	13: 92,001,757 (GRCm39)	V384A	probably damaging	Het
Clock	A	G	5: 76,413,683 (GRCm39)	S71P	probably benign	Het
Csnka2ip	A	T	16: 64,298,975 (GRCm39)	V19D	probably damaging	Het
Dcaf17	T	A	2: 70,917,744 (GRCm39)		probably null	Het
Dscam	T	C	16: 96,573,608 (GRCm39)	K785E	probably benign	Het
Eif2d	T	A	1: 131,083,465 (GRCm39)		probably benign	Het
Gal3st2b	T	C	1: 93,868,549 (GRCm39)	V258A	probably benign	Het
Gucy2c	T	C	6: 136,705,333 (GRCm39)	N534S	probably damaging	Het
Hook1	C	T	4: 95,887,023 (GRCm39)	T210I	possibly damaging	Het
Ifi203	T	C	1: 173,756,215 (GRCm39)		probably benign	Het
Irf7	T	C	7: 140,844,975 (GRCm39)		probably benign	Het
Lrp2	C	T	2: 69,297,350 (GRCm39)	V3204I	probably benign	Het
Mtx2	A	G	2: 74,699,780 (GRCm39)		probably benign	Het
Nelfcd	G	T	2: 174,265,223 (GRCm39)	V248L	probably benign	Het
Oosp1	T	C	19: 11,645,776 (GRCm39)	S121G	probably benign	Het
Or10am5	T	A	7: 6,517,808 (GRCm39)	N207Y	probably benign	Het
Sec16b	G	C	1: 157,359,718 (GRCm39)	G164R	probably benign	Het
Slc22a14	T	A	9: 118,998,919 (GRCm39)	D561V	probably benign	Het
Tet2	G	A	3: 133,193,870 (GRCm39)	T188I	probably benign	Het
Tex10	C	T	4: 48,456,800 (GRCm39)	R637Q	probably benign	Het
Trp53bp1	A	G	2: 121,101,009 (GRCm39)	V63A	possibly damaging	Het
Ube2d2a	T	G	18: 35,903,438 (GRCm39)		probably benign	Het
Vmn1r113	T	A	7: 20,521,388 (GRCm39)	V60E	probably damaging	Het

Other mutations in Cops6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00814:Cops6	APN	5	138,161,640 (GRCm39)	missense	probably damaging	1.00
IGL00929:Cops6	APN	5	138,159,648 (GRCm39)	start codon destroyed	probably null	0.02
IGL01122:Cops6	APN	5	138,160,635 (GRCm39)	missense	probably benign	0.42
IGL02652:Cops6	APN	5	138,159,700 (GRCm39)	splice site	probably null
R2271:Cops6	UTSW	5	138,159,403 (GRCm39)	missense	probably benign	0.00
R5011:Cops6	UTSW	5	138,160,459 (GRCm39)	missense	probably benign	0.00
R5294:Cops6	UTSW	5	138,159,378 (GRCm39)	unclassified	probably benign
R5394:Cops6	UTSW	5	138,161,762 (GRCm39)	splice site	probably null
R6225:Cops6	UTSW	5	138,159,673 (GRCm39)	missense	possibly damaging	0.91
R6526:Cops6	UTSW	5	138,162,162 (GRCm39)	splice site	probably null
R6943:Cops6	UTSW	5	138,161,790 (GRCm39)	missense	probably benign	0.43
R7242:Cops6	UTSW	5	138,161,842 (GRCm39)	missense	probably benign	0.18
R8692:Cops6	UTSW	5	138,162,083 (GRCm39)	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- CAGTGGCTGAACACCTGATAGCTC -3'
(R):5'- TTGCATTGCTGGGAGGGAACAC -3'

Sequencing Primer
(F):5'- TGATAGCTCAGCATAGTGCC -3'
(R):5'- CAAAGAACCAGTTCCCCAGG -3'

Posted On

2013-07-11