Incidental Mutation 'R7242:Cops6'
ID563279
Institutional Source Beutler Lab
Gene Symbol Cops6
Ensembl Gene ENSMUSG00000019494
Gene NameCOP9 signalosome subunit 6
SynonymsSgn3, VIP/MOV34, COP9 complex S6
MMRRC Submission
Accession Numbers

Genbank: NM_012002; MGI: 1349439

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7242 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location138161071-138164646 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138163580 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 96 (T96A)
Ref Sequence ENSEMBL: ENSMUSP00000121554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000505] [ENSMUST00000019638] [ENSMUST00000110951] [ENSMUST00000132639] [ENSMUST00000148879] [ENSMUST00000153867]
Predicted Effect probably benign
Transcript: ENSMUST00000000505
SMART Domains Protein: ENSMUSP00000000505
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Blast:MCM 48 132 1e-41 BLAST
MCM 145 642 N/A SMART
AAA 373 526 2.9e-4 SMART
Blast:MCM 658 719 1e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000019638
AA Change: T269A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000019638
Gene: ENSMUSG00000019494
AA Change: T269A

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
JAB_MPN 37 170 9.73e-35 SMART
Pfam:MitMem_reg 191 304 1.1e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083593
Predicted Effect probably benign
Transcript: ENSMUST00000110951
AA Change: T242A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106576
Gene: ENSMUSG00000019494
AA Change: T242A

DomainStartEndE-ValueType
JAB_MPN 10 143 9.73e-35 SMART
Pfam:MitMem_reg 163 279 2.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127881
Predicted Effect probably benign
Transcript: ENSMUST00000132639
AA Change: T96A

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000121554
Gene: ENSMUSG00000019494
AA Change: T96A

DomainStartEndE-ValueType
Pfam:MitMem_reg 17 112 3.6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142254
Predicted Effect probably benign
Transcript: ENSMUST00000148879
SMART Domains Protein: ENSMUSP00000116131
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Blast:MCM 48 132 6e-44 BLAST
MCM 145 389 1.77e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153867
SMART Domains Protein: ENSMUSP00000121566
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Pfam:MCM_N 1 58 9.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154867
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the eight subunits of COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. This protein belongs to translation initiation factor 3 (eIF3) superfamily. It is involved in the regulation of cell cycle and likely to be a cellular cofactor for HIV-1 accessory gene product Vpr. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele or a transgenic gene disruption exhibit embryonic lethality. Mice heterozygous for a gene trap allele exhibit increased sensitivity to irradiation and decreased incidence of ionizing radiation-induced tumors. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Gene trapped(15)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,128 Y354F probably damaging Het
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
4921501E09Rik A G 17: 33,067,127 Y234H probably damaging Het
Abca6 A T 11: 110,241,653 V272D possibly damaging Het
Acot11 A T 4: 106,762,493 S163R probably benign Het
Adcy5 T C 16: 35,156,835 L246P probably damaging Het
Adgra1 A T 7: 139,847,657 probably null Het
Adgra2 A G 8: 27,122,027 T1335A probably damaging Het
Armt1 T C 10: 4,453,475 S187P probably damaging Het
Azin1 T C 15: 38,501,505 M1V probably null Het
B430305J03Rik C T 3: 61,363,835 C163Y unknown Het
Cables1 T C 18: 11,840,007 S68P possibly damaging Het
Cacna1d A G 14: 30,178,706 F341L probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Celf1 T A 2: 91,003,257 C119* probably null Het
Cfap57 C T 4: 118,593,096 V610M possibly damaging Het
Chrm4 T A 2: 91,927,250 M1K probably null Het
Chrnd C T 1: 87,197,479 T418I probably damaging Het
Coch G T 12: 51,593,561 probably benign Het
Cop1 A G 1: 159,284,548 T345A probably benign Het
Corin T C 5: 72,305,055 I945V probably benign Het
Cyp2c67 G T 19: 39,617,339 T371N probably benign Het
Dap T A 15: 31,273,308 *103R probably null Het
Defb35 T A 8: 21,940,757 V49E unknown Het
Dmtf1 T A 5: 9,149,016 D39V possibly damaging Het
Dmtn T C 14: 70,618,020 T10A probably damaging Het
Dnajc1 C T 2: 18,293,972 E264K probably benign Het
Dtx3l A T 16: 35,933,401 N278K possibly damaging Het
Fam161a T A 11: 23,020,037 S72T possibly damaging Het
Fnbp4 T A 2: 90,745,796 S114T unknown Het
Focad T G 4: 88,309,906 I784S unknown Het
Fzd8 A T 18: 9,214,171 T418S probably damaging Het
Gclc A G 9: 77,785,371 Y264C probably benign Het
Ggn G A 7: 29,173,034 C649Y possibly damaging Het
Gm10184 G A 17: 89,910,135 T61I probably benign Het
Gys1 A G 7: 45,439,668 probably null Het
Hsd3b1 T C 3: 98,853,210 Y155C probably damaging Het
Htatip2 A G 7: 49,772,606 K191E probably benign Het
Ik A T 18: 36,748,222 S79C probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Mast4 A G 13: 102,738,478 S1461P probably damaging Het
Melk T A 4: 44,360,885 V555E probably damaging Het
Met G A 6: 17,491,317 C26Y probably damaging Het
Mfsd6 A T 1: 52,709,474 F77L probably damaging Het
Mib1 T A 18: 10,741,011 D86E probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr1120 G A 2: 87,358,082 V213I probably benign Het
Olfr1352 A T 10: 78,984,497 K236* probably null Het
Olfr504 T G 7: 108,565,712 S28R probably benign Het
Olfr935 A G 9: 38,995,141 I98T probably benign Het
Patj A T 4: 98,591,933 I1296L probably benign Het
Pcdh1 C T 18: 38,203,217 V122M probably benign Het
Pcdhac2 A T 18: 37,144,893 I309F possibly damaging Het
Phtf1 A G 3: 103,998,696 S565G probably damaging Het
Plekha2 A C 8: 25,088,395 F30V probably damaging Het
Ptbp1 A G 10: 79,856,388 M20V unknown Het
Pth2r A G 1: 65,388,620 D484G probably benign Het
Rapgef2 G A 3: 79,087,903 Q665* probably null Het
Scamp1 G A 13: 94,233,140 T59I probably benign Het
Sema4a T A 3: 88,450,109 D230V probably damaging Het
Snw1 C T 12: 87,468,645 G45R possibly damaging Het
Sox30 T A 11: 45,984,520 probably null Het
Sspo T A 6: 48,473,952 I2665K probably benign Het
Stx5a T A 19: 8,755,277 W437R unknown Het
Tln1 A G 4: 43,542,602 V1402A probably benign Het
Tpm1 A G 9: 67,028,101 L244P probably benign Het
Try5 T A 6: 41,313,454 E32V probably benign Het
Ttn T C 2: 76,721,729 N31188S probably benign Het
Tulp1 T C 17: 28,363,405 probably null Het
Usp13 T G 3: 32,865,743 probably null Het
Vax2 A G 6: 83,711,316 E7G possibly damaging Het
Vmn2r45 A T 7: 8,485,613 Y139* probably null Het
Wisp2 T C 2: 163,828,852 F93S probably benign Het
Zfp423 T C 8: 87,904,527 D21G probably benign Het
Other mutations in Cops6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Cops6 APN 5 138163378 missense probably damaging 1.00
IGL00929:Cops6 APN 5 138161386 start codon destroyed probably null 0.02
IGL01122:Cops6 APN 5 138162373 missense probably benign 0.42
IGL02652:Cops6 APN 5 138161438 unclassified probably null
R0593:Cops6 UTSW 5 138163580 missense probably benign 0.18
R2271:Cops6 UTSW 5 138161141 missense probably benign 0.00
R5011:Cops6 UTSW 5 138162197 missense probably benign 0.00
R5294:Cops6 UTSW 5 138161116 unclassified probably benign
R5394:Cops6 UTSW 5 138163500 splice site probably null
R6225:Cops6 UTSW 5 138161411 missense possibly damaging 0.91
R6526:Cops6 UTSW 5 138163900 unclassified probably null
R6943:Cops6 UTSW 5 138163528 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GCCATCAAGATGCTGCACAG -3'
(R):5'- AGCCCCACGTCATTGCATTG -3'

Sequencing Primer
(F):5'- TATGTCAAGGCCTCTGAAGC -3'
(R):5'- CCACGTCATTGCATTGCTGGG -3'
Posted On2019-06-26