Incidental Mutation 'R7226:Fbxo3'
ID562137
Institutional Source Beutler Lab
Gene Symbol Fbxo3
Ensembl Gene ENSMUSG00000027180
Gene NameF-box protein 3
SynonymsFba, 1200002G09Rik, 1700026K02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R7226 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location104027721-104063240 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104050297 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 251 (S251T)
Ref Sequence ENSEMBL: ENSMUSP00000028603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028603] [ENSMUST00000102565] [ENSMUST00000111135] [ENSMUST00000111136]
Predicted Effect probably benign
Transcript: ENSMUST00000028603
AA Change: S251T

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000028603
Gene: ENSMUSG00000027180
AA Change: S251T

DomainStartEndE-ValueType
FBOX 16 56 2.83e-4 SMART
SMI1_KNR4 121 251 3.02e-5 SMART
Pfam:DUF525 294 384 3.1e-30 PFAM
coiled coil region 417 446 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102565
AA Change: S251T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099625
Gene: ENSMUSG00000027180
AA Change: S251T

DomainStartEndE-ValueType
FBOX 16 56 2.83e-4 SMART
SMI1_KNR4 121 251 3.02e-5 SMART
Pfam:DUF525 293 385 1.8e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111135
AA Change: S246T

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106765
Gene: ENSMUSG00000027180
AA Change: S246T

DomainStartEndE-ValueType
SCOP:d1fs1a1 14 48 4e-3 SMART
Blast:FBOX 16 51 2e-13 BLAST
SMI1_KNR4 116 246 3.02e-5 SMART
Pfam:DUF525 288 380 1.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111136
AA Change: S251T

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106766
Gene: ENSMUSG00000027180
AA Change: S251T

DomainStartEndE-ValueType
FBOX 16 56 2.83e-4 SMART
SMI1_KNR4 121 251 3.02e-5 SMART
Pfam:DUF525 293 361 1.2e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternative splicing of this gene generates 2 transcript variants diverging at the 3' end. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025B11Rik C T 15: 77,558,989 V17I unknown Het
Acad8 T A 9: 26,978,430 K323* probably null Het
Adam18 A T 8: 24,647,808 C339S probably damaging Het
Anxa7 A G 14: 20,460,195 F396L probably damaging Het
Ap2m1 T A 16: 20,539,451 V73D probably damaging Het
Asic2 A T 11: 80,971,514 I270N probably damaging Het
Atrn T G 2: 130,986,744 C1070G probably damaging Het
Bag6 A G 17: 35,142,945 N517S unknown Het
Cavin1 A C 11: 100,970,458 D3E probably benign Het
Cc2d2b T C 19: 40,791,307 L571P unknown Het
Ccbe1 A T 18: 66,083,128 C175S probably damaging Het
Cd19 A G 7: 126,414,823 L5P unknown Het
Cd46 A G 1: 195,042,006 S362P possibly damaging Het
Celf5 A G 10: 81,468,029 S198P probably damaging Het
Cep170b A G 12: 112,737,925 R706G possibly damaging Het
Chd3 G T 11: 69,369,211 R61S unknown Het
Cpsf6 A C 10: 117,361,822 W253G unknown Het
Cyp27a1 G A 1: 74,737,348 G481D probably damaging Het
Ddr1 C T 17: 35,691,147 D218N possibly damaging Het
Dhx34 A T 7: 16,198,876 V1046D probably damaging Het
Dhx9 A T 1: 153,465,677 D608E probably benign Het
Dnajc6 C A 4: 101,639,372 A912E probably damaging Het
Ehmt1 T C 2: 24,804,782 D1051G probably damaging Het
Fam217b C A 2: 178,421,203 A320E probably benign Het
Farsa T A 8: 84,864,060 I169N probably benign Het
Fbn2 A G 18: 58,037,070 C2210R probably damaging Het
Fer1l6 C T 15: 58,590,535 T813I probably benign Het
Ftl1-ps1 A T 13: 74,406,995 E131V probably damaging Het
Gins3 T A 8: 95,637,871 I83N probably damaging Het
Gja3 T C 14: 57,035,893 T341A probably benign Het
Gja5 A G 3: 97,050,858 Y77C probably damaging Het
Gm14085 C A 2: 122,522,532 R453S probably benign Het
Gm5096 A G 18: 87,757,466 D371G possibly damaging Het
Gm7247 A G 14: 51,365,351 K48R probably damaging Het
Gsx2 C A 5: 75,075,960 S67* probably null Het
H2-Q5 T A 17: 35,397,113 L217Q Het
Impg2 T A 16: 56,267,104 C1095* probably null Het
Itga7 G T 10: 128,940,932 W222L probably damaging Het
Kdm2b T A 5: 122,921,449 D530V possibly damaging Het
Klhdc8a A T 1: 132,302,606 D153V probably damaging Het
Lin28a C T 4: 134,006,308 G143S probably damaging Het
Memo1 A G 17: 74,202,343 L227S probably damaging Het
Mettl27 T A 5: 134,935,803 V138E probably damaging Het
Mov10 G T 3: 104,801,012 L474I probably damaging Het
Nat10 T C 2: 103,726,753 N852S probably benign Het
Nfkbie T C 17: 45,559,227 V166A possibly damaging Het
Nktr T C 9: 121,746,533 M369T probably damaging Het
Nlrp9a A T 7: 26,558,724 N589I probably benign Het
Nrn1 G A 13: 36,730,603 R8C probably benign Het
Nrsn1 A G 13: 25,253,468 I159T probably damaging Het
Olfr132 C T 17: 38,130,433 G253D probably benign Het
Olfr389 A G 11: 73,776,677 S217P possibly damaging Het
Olfr485 A T 7: 108,158,957 D305E probably benign Het
Olfr794 G A 10: 129,570,715 G20D probably benign Het
Osbp T A 19: 11,978,667 D385E probably benign Het
Pan3 T A 5: 147,526,992 N547K probably damaging Het
Pum1 C A 4: 130,771,981 T1036K probably damaging Het
Rad54l2 C A 9: 106,713,472 R485L probably damaging Het
Rps26 A T 10: 128,625,218 F101I unknown Het
Sdsl T C 5: 120,460,637 N138S probably benign Het
Slc39a6 A T 18: 24,584,027 H649Q probably damaging Het
Snip1 T A 4: 125,071,480 F226Y probably benign Het
Srrd T C 5: 112,337,456 T334A unknown Het
St14 C T 9: 31,100,152 D448N possibly damaging Het
Tmem270 T A 5: 134,901,684 Q241L probably benign Het
Tmem55a T A 4: 14,892,464 D109E probably damaging Het
Tubb4b T C 2: 25,224,168 D41G probably benign Het
Uhrf1bp1l A T 10: 89,808,641 Q1181L probably benign Het
Usf3 T C 16: 44,220,005 M1616T possibly damaging Het
Vmn2r95 A T 17: 18,451,983 I733F possibly damaging Het
Zfp976 A T 7: 42,613,260 C385* probably null Het
Other mutations in Fbxo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Fbxo3 APN 2 104033676 missense probably benign 0.25
IGL02187:Fbxo3 APN 2 104027950 missense probably damaging 0.99
IGL02323:Fbxo3 APN 2 104047951 missense probably benign 0.38
IGL02941:Fbxo3 APN 2 104050294 missense probably damaging 1.00
IGL03160:Fbxo3 APN 2 104030347 nonsense probably null
IGL03346:Fbxo3 APN 2 104050294 missense probably damaging 1.00
R2163:Fbxo3 UTSW 2 104054985 missense probably benign 0.20
R2899:Fbxo3 UTSW 2 104051135 missense probably damaging 1.00
R4256:Fbxo3 UTSW 2 104051165 missense probably damaging 1.00
R4663:Fbxo3 UTSW 2 104053475 missense probably damaging 1.00
R4914:Fbxo3 UTSW 2 104054966 missense probably damaging 1.00
R4915:Fbxo3 UTSW 2 104054966 missense probably damaging 1.00
R4918:Fbxo3 UTSW 2 104054966 missense probably damaging 1.00
R7001:Fbxo3 UTSW 2 104051224 missense probably damaging 1.00
R7223:Fbxo3 UTSW 2 104043012 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTCCCTAACAAAAGATAGGCAGGG -3'
(R):5'- GGACAGTGAAGTTCATTTCTTAACC -3'

Sequencing Primer
(F):5'- CCCAGTACCTATGTGAAAGCTTGG -3'
(R):5'- ACCTTCCAAATCTCATCTCATGATAG -3'
Posted On2019-06-26