Incidental Mutation 'R7385:Gopc'
ID573041
Institutional Source Beutler Lab
Gene Symbol Gopc
Ensembl Gene ENSMUSG00000019861
Gene Namegolgi associated PDZ and coiled-coil motif containing
Synonyms2210402P09Rik, GOPC1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.423) question?
Stock #R7385 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location52335850-52382124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 52349232 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 299 (G299E)
Ref Sequence ENSEMBL: ENSMUSP00000020008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020008] [ENSMUST00000105475] [ENSMUST00000217753] [ENSMUST00000217995]
Predicted Effect probably damaging
Transcript: ENSMUST00000020008
AA Change: G299E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020008
Gene: ENSMUSG00000019861
AA Change: G299E

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
coiled coil region 85 125 N/A INTRINSIC
Blast:PDZ 192 232 5e-10 BLAST
PDZ 290 364 5.41e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105475
AA Change: G307E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101115
Gene: ENSMUSG00000019861
AA Change: G307E

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
coiled coil region 85 125 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
Blast:PDZ 200 240 5e-10 BLAST
PDZ 298 372 5.41e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000217753
AA Change: G247E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217995
Meta Mutation Damage Score 0.9252 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Golgi protein with a PDZ domain. The PDZ domain is globular and proteins which contain them bind other proteins through short motifs near the C-termini. Mice which are deficient in the orthologous protein have globozoospermia and are infertile. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele show male sterility with globozoospermia characterized by a complete lack of acrosomes due to failure of vesicle transport from the Golgi apparatus, a malformed sperm nucleus, and abnormal mitochondrial arrangement in the mitochondrial sheath of mutant spermatozoa. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,287,737 E3146D probably benign Het
4932415D10Rik T C 10: 82,287,895 S3094G probably benign Het
Ahctf1 T C 1: 179,753,381 E1752G possibly damaging Het
Aqp3 T C 4: 41,095,178 T68A probably damaging Het
Arhgap40 A G 2: 158,543,227 K463R probably damaging Het
Asb10 A T 5: 24,533,738 C440* probably null Het
Bach1 A G 16: 87,729,497 T616A probably damaging Het
Braf T A 6: 39,665,108 probably null Het
Cacna1s A T 1: 136,092,633 N803Y probably damaging Het
Cald1 A G 6: 34,686,065 E21G probably damaging Het
Caskin1 G T 17: 24,503,924 G589C probably damaging Het
Cdc37l1 T C 19: 28,990,671 probably null Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col5a1 T C 2: 28,024,750 L1615P unknown Het
Cpt1a C A 19: 3,380,155 P672T probably damaging Het
Defb22 A G 2: 152,486,197 Y23H probably damaging Het
Depdc1b G C 13: 108,363,632 K226N probably damaging Het
Derl2 A G 11: 71,018,938 probably benign Het
Dnaja2 T C 8: 85,539,353 T368A probably benign Het
Dsg3 C A 18: 20,540,197 T975K possibly damaging Het
Eif4enif1 T A 11: 3,220,269 D107E probably damaging Het
Fut11 A G 14: 20,696,257 D389G probably damaging Het
Gprin1 T C 13: 54,738,610 D617G probably benign Het
Grin2d A G 7: 45,857,536 V505A probably damaging Het
Heatr6 T C 11: 83,759,335 Y206H probably damaging Het
Hhex C A 19: 37,437,265 N147K probably damaging Het
Igkv4-80 G A 6: 69,016,715 S64F probably damaging Het
Jakmip3 A G 7: 139,023,339 K360R possibly damaging Het
Kat5 T A 19: 5,608,274 N191I probably benign Het
Kat5 AG A 19: 5,608,269 probably null Het
Kifc5b A G 17: 26,925,623 D572G probably damaging Het
Lrp5 C A 19: 3,612,197 probably null Het
Lrtm1 A G 14: 29,027,716 M345V probably benign Het
Mbd5 T C 2: 49,272,449 V981A probably benign Het
Mier3 G A 13: 111,705,249 G115S possibly damaging Het
Mrgprd A G 7: 145,321,524 N44S probably damaging Het
Mrps10 C A 17: 47,378,221 P181Q probably damaging Het
Myot T A 18: 44,337,008 C17* probably null Het
Myt1 A G 2: 181,767,705 probably null Het
Ncoa6 C A 2: 155,407,801 L1194F probably damaging Het
Olfr1355 C A 10: 78,879,454 T94K probably damaging Het
Olfr1423 T C 19: 12,035,999 T248A probably benign Het
Olfr1428 T C 19: 12,108,697 N57S probably damaging Het
Olfr1507 T C 14: 52,490,181 Y261C probably damaging Het
Olfr58 T A 9: 19,783,211 I26N possibly damaging Het
Osbpl6 G A 2: 76,549,450 G128E probably damaging Het
P3h3 A T 6: 124,855,270 Y218N probably damaging Het
Paxip1 A G 5: 27,781,420 probably null Het
Pdia5 T C 16: 35,429,914 Y225C probably damaging Het
Pik3c2g T G 6: 139,855,353 M526R Het
Prox1 A G 1: 190,162,126 F41L probably benign Het
Psd3 A T 8: 68,000,756 F284I probably damaging Het
Rev3l T A 10: 39,823,682 C1392S probably benign Het
Rfxank A T 8: 70,134,635 V212E probably damaging Het
Ros1 T C 10: 52,155,126 D482G probably benign Het
Sat2 A T 11: 69,622,937 I94F probably damaging Het
Scarf2 T C 16: 17,803,838 L384P probably damaging Het
Sec14l2 C A 11: 4,116,750 E21* probably null Het
Slitrk5 T A 14: 111,680,699 V585E probably benign Het
Tas2r130 T A 6: 131,630,263 M190L probably benign Het
Ticrr G A 7: 79,691,849 S1061N possibly damaging Het
Tlr9 C A 9: 106,225,264 H585N probably damaging Het
Tmem219 A T 7: 126,896,775 I142N probably damaging Het
Tnni2 A G 7: 142,443,178 N8S probably benign Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Ttc8 A G 12: 98,942,288 E72G possibly damaging Het
Upf1 A G 8: 70,340,618 Y297H probably damaging Het
Vmn1r4 A G 6: 56,956,736 K75R probably damaging Het
Vmn2r78 G A 7: 86,922,425 G481D probably benign Het
Vmn2r96 A G 17: 18,583,040 Y404C probably damaging Het
Vps50 T A 6: 3,602,708 S942T probably benign Het
Xkr7 C A 2: 153,054,063 S279* probably null Het
Zan G A 5: 137,434,154 Q2294* probably null Het
Zan T C 5: 137,450,491 Y1700C unknown Het
Other mutations in Gopc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Gopc APN 10 52349230 missense probably damaging 0.98
IGL01146:Gopc APN 10 52358867 missense probably benign 0.31
Forgetful UTSW 10 52349143 missense probably damaging 1.00
Non_compos UTSW 10 52349232 missense probably damaging 1.00
R0281:Gopc UTSW 10 52350678 missense probably damaging 0.98
R0798:Gopc UTSW 10 52358811 missense probably damaging 0.97
R2238:Gopc UTSW 10 52353403 missense probably damaging 1.00
R2255:Gopc UTSW 10 52349085 missense probably damaging 0.99
R2507:Gopc UTSW 10 52353326 critical splice donor site probably null
R4153:Gopc UTSW 10 52349143 missense probably damaging 1.00
R5484:Gopc UTSW 10 52358846 missense probably damaging 1.00
R5936:Gopc UTSW 10 52346199 missense probably damaging 1.00
R7806:Gopc UTSW 10 52353429 missense probably damaging 0.98
R7844:Gopc UTSW 10 52339749 missense possibly damaging 0.60
R8066:Gopc UTSW 10 52354716 missense probably benign 0.03
X0019:Gopc UTSW 10 52339741 missense probably benign 0.43
Z1177:Gopc UTSW 10 52350663 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACATCCATAAGCGTCAAGG -3'
(R):5'- TCTTAGTTATTGTACTCAGAGGTGC -3'

Sequencing Primer
(F):5'- CATCCATAAGCGTCAAGGAATAG -3'
(R):5'- ACTCAGAGGTGCCTTTTTGG -3'
Posted On2019-09-13