Incidental Mutation 'R7385:Prox1'
ID573004
Institutional Source Beutler Lab
Gene Symbol Prox1
Ensembl Gene ENSMUSG00000010175
Gene Nameprospero homeobox 1
SynonymsA230003G05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7385 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location190118035-190170714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 190162126 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 41 (F41L)
Ref Sequence ENSEMBL: ENSMUSP00000010319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010319] [ENSMUST00000175916] [ENSMUST00000177288]
Predicted Effect probably benign
Transcript: ENSMUST00000010319
AA Change: F41L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000010319
Gene: ENSMUSG00000010175
AA Change: F41L

DomainStartEndE-ValueType
low complexity region 208 223 N/A INTRINSIC
SCOP:d1fxkc_ 227 363 9e-5 SMART
low complexity region 514 526 N/A INTRINSIC
low complexity region 529 545 N/A INTRINSIC
Pfam:HPD 578 735 8.9e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175916
AA Change: F41L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135703
Gene: ENSMUSG00000010175
AA Change: F41L

DomainStartEndE-ValueType
low complexity region 208 223 N/A INTRINSIC
SCOP:d1fxkc_ 227 363 9e-5 SMART
low complexity region 514 526 N/A INTRINSIC
low complexity region 529 545 N/A INTRINSIC
Pfam:HPD 578 735 8.9e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177288
AA Change: F41L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135066
Gene: ENSMUSG00000010175
AA Change: F41L

DomainStartEndE-ValueType
low complexity region 208 223 N/A INTRINSIC
SCOP:d1fxkc_ 227 363 9e-5 SMART
low complexity region 514 526 N/A INTRINSIC
low complexity region 529 545 N/A INTRINSIC
Pfam:HPD 579 732 2.2e-86 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the homeobox transcription factor family. Members of this family contain a homeobox domain that consists of a 60-amino acid helix-turn-helix structure that binds DNA and RNA. The protein encoded by this gene is conserved across vertebrates and may play an essential role during development. Altered levels of this protein have been reported in cancers of different organs, such as colon, brain, blood, breast, pancreas, liver and esophagus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality with impaired development of the lens, lymphatic system, liver and pancreas. Heterozygous mutation results in early postnatal lethality with varying penetrance on different genetic backgrounds, obesity and lymphatic vessel abnormalities [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,287,737 E3146D probably benign Het
4932415D10Rik T C 10: 82,287,895 S3094G probably benign Het
Ahctf1 T C 1: 179,753,381 E1752G possibly damaging Het
Aqp3 T C 4: 41,095,178 T68A probably damaging Het
Arhgap40 A G 2: 158,543,227 K463R probably damaging Het
Asb10 A T 5: 24,533,738 C440* probably null Het
Bach1 A G 16: 87,729,497 T616A probably damaging Het
Braf T A 6: 39,665,108 probably null Het
Cacna1s A T 1: 136,092,633 N803Y probably damaging Het
Cald1 A G 6: 34,686,065 E21G probably damaging Het
Caskin1 G T 17: 24,503,924 G589C probably damaging Het
Cdc37l1 T C 19: 28,990,671 probably null Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col5a1 T C 2: 28,024,750 L1615P unknown Het
Cpt1a C A 19: 3,380,155 P672T probably damaging Het
Defb22 A G 2: 152,486,197 Y23H probably damaging Het
Depdc1b G C 13: 108,363,632 K226N probably damaging Het
Derl2 A G 11: 71,018,938 probably benign Het
Dnaja2 T C 8: 85,539,353 T368A probably benign Het
Dsg3 C A 18: 20,540,197 T975K possibly damaging Het
Eif4enif1 T A 11: 3,220,269 D107E probably damaging Het
Fut11 A G 14: 20,696,257 D389G probably damaging Het
Gopc C T 10: 52,349,232 G299E probably damaging Het
Gprin1 T C 13: 54,738,610 D617G probably benign Het
Grin2d A G 7: 45,857,536 V505A probably damaging Het
Heatr6 T C 11: 83,759,335 Y206H probably damaging Het
Hhex C A 19: 37,437,265 N147K probably damaging Het
Igkv4-80 G A 6: 69,016,715 S64F probably damaging Het
Jakmip3 A G 7: 139,023,339 K360R possibly damaging Het
Kat5 T A 19: 5,608,274 N191I probably benign Het
Kat5 AG A 19: 5,608,269 probably null Het
Kifc5b A G 17: 26,925,623 D572G probably damaging Het
Lrp5 C A 19: 3,612,197 probably null Het
Lrtm1 A G 14: 29,027,716 M345V probably benign Het
Mbd5 T C 2: 49,272,449 V981A probably benign Het
Mier3 G A 13: 111,705,249 G115S possibly damaging Het
Mrgprd A G 7: 145,321,524 N44S probably damaging Het
Mrps10 C A 17: 47,378,221 P181Q probably damaging Het
Myot T A 18: 44,337,008 C17* probably null Het
Myt1 A G 2: 181,767,705 probably null Het
Ncoa6 C A 2: 155,407,801 L1194F probably damaging Het
Olfr1355 C A 10: 78,879,454 T94K probably damaging Het
Olfr1423 T C 19: 12,035,999 T248A probably benign Het
Olfr1428 T C 19: 12,108,697 N57S probably damaging Het
Olfr1507 T C 14: 52,490,181 Y261C probably damaging Het
Olfr58 T A 9: 19,783,211 I26N possibly damaging Het
Osbpl6 G A 2: 76,549,450 G128E probably damaging Het
P3h3 A T 6: 124,855,270 Y218N probably damaging Het
Paxip1 A G 5: 27,781,420 probably null Het
Pdia5 T C 16: 35,429,914 Y225C probably damaging Het
Pik3c2g T G 6: 139,855,353 M526R Het
Psd3 A T 8: 68,000,756 F284I probably damaging Het
Rev3l T A 10: 39,823,682 C1392S probably benign Het
Rfxank A T 8: 70,134,635 V212E probably damaging Het
Ros1 T C 10: 52,155,126 D482G probably benign Het
Sat2 A T 11: 69,622,937 I94F probably damaging Het
Scarf2 T C 16: 17,803,838 L384P probably damaging Het
Sec14l2 C A 11: 4,116,750 E21* probably null Het
Slitrk5 T A 14: 111,680,699 V585E probably benign Het
Tas2r130 T A 6: 131,630,263 M190L probably benign Het
Ticrr G A 7: 79,691,849 S1061N possibly damaging Het
Tlr9 C A 9: 106,225,264 H585N probably damaging Het
Tmem219 A T 7: 126,896,775 I142N probably damaging Het
Tnni2 A G 7: 142,443,178 N8S probably benign Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Ttc8 A G 12: 98,942,288 E72G possibly damaging Het
Upf1 A G 8: 70,340,618 Y297H probably damaging Het
Vmn1r4 A G 6: 56,956,736 K75R probably damaging Het
Vmn2r78 G A 7: 86,922,425 G481D probably benign Het
Vmn2r96 A G 17: 18,583,040 Y404C probably damaging Het
Vps50 T A 6: 3,602,708 S942T probably benign Het
Xkr7 C A 2: 153,054,063 S279* probably null Het
Zan G A 5: 137,434,154 Q2294* probably null Het
Zan T C 5: 137,450,491 Y1700C unknown Het
Other mutations in Prox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Prox1 APN 1 190123410 splice site probably benign
IGL01729:Prox1 APN 1 190161175 missense probably benign
IGL02167:Prox1 APN 1 190161280 missense probably benign 0.13
IGL02416:Prox1 APN 1 190161130 missense probably benign 0.00
IGL02419:Prox1 APN 1 190161130 missense probably benign 0.00
IGL03234:Prox1 APN 1 190161636 missense probably damaging 1.00
R0069:Prox1 UTSW 1 190160919 missense possibly damaging 0.85
R0514:Prox1 UTSW 1 190161456 missense probably damaging 0.99
R1249:Prox1 UTSW 1 190147061 missense possibly damaging 0.94
R1299:Prox1 UTSW 1 190146943 splice site probably benign
R1601:Prox1 UTSW 1 190161006 missense probably damaging 0.99
R1893:Prox1 UTSW 1 190160518 splice site probably benign
R2090:Prox1 UTSW 1 190160812 missense probably damaging 0.99
R2366:Prox1 UTSW 1 190161882 missense probably damaging 0.96
R4614:Prox1 UTSW 1 190162008 missense probably damaging 0.99
R4799:Prox1 UTSW 1 190153472 missense probably damaging 0.98
R4873:Prox1 UTSW 1 190162122 missense probably damaging 0.99
R4875:Prox1 UTSW 1 190162122 missense probably damaging 0.99
R5124:Prox1 UTSW 1 190161279 missense possibly damaging 0.73
R5149:Prox1 UTSW 1 190147053 missense possibly damaging 0.89
R5256:Prox1 UTSW 1 190161441 missense probably benign 0.02
R5545:Prox1 UTSW 1 190147142 missense probably damaging 1.00
R5985:Prox1 UTSW 1 190146955 missense possibly damaging 0.93
R5993:Prox1 UTSW 1 190162239 missense probably damaging 1.00
R6833:Prox1 UTSW 1 190160778 missense probably damaging 0.99
R7335:Prox1 UTSW 1 190161845 missense possibly damaging 0.93
R7572:Prox1 UTSW 1 190123386 missense probably benign 0.10
R7608:Prox1 UTSW 1 190153445 missense probably benign 0.24
R7655:Prox1 UTSW 1 190162221 missense probably damaging 0.99
R7656:Prox1 UTSW 1 190162221 missense probably damaging 0.99
R8070:Prox1 UTSW 1 190160910 missense probably damaging 0.96
Z1088:Prox1 UTSW 1 190161999 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGTACTTCGGAGCCTGTGC -3'
(R):5'- ATTCTTGAGCTGTGCCCAG -3'

Sequencing Primer
(F):5'- AGAGTCCGCTGGCTTGGAAAC -3'
(R):5'- GCTGACGAGCTTTTGAAGATGGC -3'
Posted On2019-09-13