Incidental Mutation 'R7465:Agtr1a'
ID578722
Institutional Source Beutler Lab
Gene Symbol Agtr1a
Ensembl Gene ENSMUSG00000049115
Gene Nameangiotensin II receptor, type 1a
SynonymsAngtr-1a, Agtr1a, Agtr-1a, 1810074K20Rik, AT1, AT1a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7465 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location30336441-30382867 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30381981 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 343 (D343V)
Ref Sequence ENSEMBL: ENSMUSP00000070958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066412] [ENSMUST00000221743] [ENSMUST00000222370] [ENSMUST00000222503] [ENSMUST00000223201]
Predicted Effect probably benign
Transcript: ENSMUST00000066412
AA Change: D343V

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000070958
Gene: ENSMUSG00000049115
AA Change: D343V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 39 316 8.2e-10 PFAM
Pfam:7tm_1 45 302 1.8e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221743
Predicted Effect probably benign
Transcript: ENSMUST00000222370
Predicted Effect probably benign
Transcript: ENSMUST00000222503
Predicted Effect probably benign
Transcript: ENSMUST00000223201
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiotensin II is a potent vasopressor hormone and a primary regulator of aldosterone secretion. It is an important effector controlling blood pressure and volume in the cardiovascular system. It acts through at least two types of receptors. This gene encodes the type 1 receptor which is thought to mediate the major cardiovascular effects of angiotensin II. This gene may play a role in the generation of reperfusion arrhythmias following restoration of blood flow to ischemic or infarcted myocardium. It was previously thought that a related gene, denoted as AGTR1B, existed; however, it is now believed that there is only one type 1 receptor gene in humans. Multiple alternatively spliced transcript variants have been reported for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous inactivation of this gene causes hypotension and hyperreninemia, alters drinking behavior and vascular and hemodynamic responses to angiotensin II, and may lead to abnormal physiological response to xenobiotics, abnormal kidney morphology, andreduced cell numbers in specific brain areas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks1 G A 17: 28,054,323 R972Q possibly damaging Het
Atp2a2 T C 5: 122,461,700 K543E probably benign Het
Atp8b5 G A 4: 43,271,269 V4I probably benign Het
Bcar3 A T 3: 122,523,230 N617Y probably benign Het
Blm A G 7: 80,513,115 S163P probably benign Het
Cbx3 A G 6: 51,478,530 D87G probably benign Het
Celsr1 A G 15: 86,033,392 S127P probably benign Het
Cndp1 A T 18: 84,619,541 M356K probably damaging Het
Cnn2 G A 10: 79,992,527 E113K probably damaging Het
Col17a1 T A 19: 47,668,105 R573* probably null Het
Cttnbp2 T A 6: 18,501,992 E49V probably damaging Het
Dynlrb2 T A 8: 116,514,957 V80E possibly damaging Het
Ehbp1 A G 11: 22,138,001 V386A probably benign Het
Elfn1 C T 5: 139,972,087 P282L probably benign Het
Fam69a T C 5: 107,909,684 D336G probably damaging Het
Fan1 G A 7: 64,353,638 T812I probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat1 G A 8: 45,044,152 V4225I probably benign Het
Frem1 A G 4: 82,914,835 C1873R probably benign Het
Fsd1l T C 4: 53,647,755 I66T probably benign Het
Gabrr1 C A 4: 33,146,970 D52E probably benign Het
Il18rap T C 1: 40,543,089 L390P probably damaging Het
Il27ra T A 8: 84,039,612 D181V probably benign Het
Irgq C A 7: 24,534,409 H558Q probably damaging Het
Itsn2 C T 12: 4,706,983 Q1358* probably null Het
Kmt2c C T 5: 25,302,849 G3197S probably damaging Het
Lrrk2 A G 15: 91,767,340 Y1733C probably damaging Het
Mapk7 G A 11: 61,490,453 A510V probably damaging Het
Mtch1 A T 17: 29,332,724 C385S probably benign Het
Nfib A G 4: 82,353,521 probably null Het
Nostrin C T 2: 69,185,507 T448M possibly damaging Het
Olfr1066 A G 2: 86,455,806 V155A probably benign Het
Olfr1255 T C 2: 89,816,536 L64P probably damaging Het
Olfr1436 T C 19: 12,298,437 I232V probably benign Het
Olfr1441 T A 19: 12,423,145 Y279N probably damaging Het
Olfr533 T A 7: 140,466,798 V199D probably damaging Het
Olfr670 A G 7: 104,959,917 Y272H probably benign Het
Pcdha2 T C 18: 36,940,330 V338A probably damaging Het
Pcdhgc3 A G 18: 37,807,745 T400A probably benign Het
Piezo2 C T 18: 63,012,723 S2710N probably benign Het
Ppp4r1 T A 17: 65,831,020 Y591* probably null Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rab42 T C 4: 132,302,614 E99G possibly damaging Het
Rd3l A T 12: 111,979,482 W188R probably damaging Het
Sap30bp A G 11: 115,951,968 D89G probably benign Het
Sptbn4 T C 7: 27,366,689 T1985A probably benign Het
Tec T C 5: 72,773,880 Y247C probably damaging Het
Tek G A 4: 94,827,826 probably null Het
Tex14 T C 11: 87,514,430 S723P possibly damaging Het
Thumpd3 T A 6: 113,047,631 L62Q probably damaging Het
Tlr12 A T 4: 128,616,170 D762E probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Txndc16 T A 14: 45,165,388 I316F probably damaging Het
Vamp1 T C 6: 125,218,575 S2P unknown Het
Vmn1r211 T A 13: 22,851,916 M194L probably benign Het
Zfp874a T A 13: 67,442,257 Q436L probably damaging Het
Other mutations in Agtr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Agtr1a APN 13 30381828 missense probably damaging 1.00
IGL01738:Agtr1a APN 13 30381038 missense probably benign 0.00
IGL01870:Agtr1a APN 13 30381327 missense probably damaging 1.00
IGL02293:Agtr1a APN 13 30381357 missense probably benign
IGL03411:Agtr1a APN 13 30381599 missense possibly damaging 0.49
R0012:Agtr1a UTSW 13 30381749 missense probably damaging 0.99
R0148:Agtr1a UTSW 13 30381944 missense probably benign 0.33
R0584:Agtr1a UTSW 13 30381034 missense probably damaging 1.00
R0622:Agtr1a UTSW 13 30381681 missense probably benign 0.00
R0730:Agtr1a UTSW 13 30381296 missense probably damaging 1.00
R1195:Agtr1a UTSW 13 30381918 missense probably damaging 0.99
R1195:Agtr1a UTSW 13 30381918 missense probably damaging 0.99
R1195:Agtr1a UTSW 13 30381918 missense probably damaging 0.99
R4075:Agtr1a UTSW 13 30381834 missense probably damaging 1.00
R4757:Agtr1a UTSW 13 30381859 nonsense probably null
R5677:Agtr1a UTSW 13 30381584 missense probably damaging 1.00
R5722:Agtr1a UTSW 13 30382033 makesense probably null
R6355:Agtr1a UTSW 13 30381499 missense probably benign 0.04
R6633:Agtr1a UTSW 13 30381467 missense probably benign 0.01
R7325:Agtr1a UTSW 13 30381907 missense possibly damaging 0.86
R7358:Agtr1a UTSW 13 30380979 missense probably benign 0.05
X0025:Agtr1a UTSW 13 30381468 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CTGCCATGCCCATAACCATCTG -3'
(R):5'- AGCTTTCTCTCAGAGCTTCAG -3'

Sequencing Primer
(F):5'- GCATAGCGTATTTTAACAACTGCCTG -3'
(R):5'- GCTTTGAACCTGTCACTC -3'
Posted On2019-10-07