Incidental Mutation 'R7609:Ankrd39'
ID588458
Institutional Source Beutler Lab
Gene Symbol Ankrd39
Ensembl Gene ENSMUSG00000079610
Gene Nameankyrin repeat domain 39
SynonymsC030004B10Rik, 9130416N05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7609 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location36537507-36547445 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36539465 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 160 (R160W)
Ref Sequence ENSEMBL: ENSMUSP00000001172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001172] [ENSMUST00000054665] [ENSMUST00000191849] [ENSMUST00000193083] [ENSMUST00000194853] [ENSMUST00000194894] [ENSMUST00000207088] [ENSMUST00000207843]
Predicted Effect probably damaging
Transcript: ENSMUST00000001172
AA Change: R160W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001172
Gene: ENSMUSG00000079610
AA Change: R160W

DomainStartEndE-ValueType
ANK 30 59 8.77e2 SMART
ANK 63 92 1.08e-5 SMART
ANK 96 127 1.27e-2 SMART
ANK 129 158 5.62e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054665
SMART Domains Protein: ENSMUSP00000061168
Gene: ENSMUSG00000067653

DomainStartEndE-ValueType
coiled coil region 45 74 N/A INTRINSIC
low complexity region 79 94 N/A INTRINSIC
Blast:ANK 111 140 1e-9 BLAST
ANK 144 173 1.12e-3 SMART
ANK 177 206 1.4e-4 SMART
ANK 210 239 9.27e-5 SMART
ANK 243 272 7.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191849
SMART Domains Protein: ENSMUSP00000142202
Gene: ENSMUSG00000109510

DomainStartEndE-ValueType
Blast:ANK 1 26 9e-9 BLAST
ANK 30 59 1.12e-3 SMART
ANK 63 92 1.4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193083
SMART Domains Protein: ENSMUSP00000141394
Gene: ENSMUSG00000067653

DomainStartEndE-ValueType
Blast:ANK 1 26 1e-8 BLAST
ANK 30 59 6.9e-6 SMART
ANK 63 92 8.9e-7 SMART
ANK 96 125 5.7e-7 SMART
ANK 129 158 4.6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194853
SMART Domains Protein: ENSMUSP00000141541
Gene: ENSMUSG00000067653

DomainStartEndE-ValueType
coiled coil region 45 74 N/A INTRINSIC
low complexity region 79 94 N/A INTRINSIC
Blast:ANK 111 140 2e-9 BLAST
ANK 144 173 1.12e-3 SMART
ANK 177 206 1.4e-4 SMART
ANK 210 239 7.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194894
SMART Domains Protein: ENSMUSP00000141712
Gene: ENSMUSG00000079610

DomainStartEndE-ValueType
ANK 30 59 5.6e0 SMART
ANK 63 92 7.1e-8 SMART
ANK 96 127 8.2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207088
Predicted Effect probably benign
Transcript: ENSMUST00000207843
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (69/72)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,989,460 Y288C probably benign Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Agl C A 3: 116,807,279 R24I possibly damaging Het
Aldoart2 A G 12: 55,566,048 T253A probably benign Het
Aspscr1 C T 11: 120,677,522 T57M probably damaging Het
Baz2b A G 2: 59,962,473 L437S probably benign Het
Bcl9l T A 9: 44,505,747 L331Q probably damaging Het
Cdhr4 C A 9: 107,997,283 P546T probably damaging Het
Cfap61 T C 2: 146,112,533 C231R unknown Het
Cnih4 T C 1: 181,155,902 L61P probably damaging Het
Dtx4 A G 19: 12,492,281 Y161H probably damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Ercc6 A G 14: 32,566,361 H830R probably benign Het
Exoc7 T C 11: 116,289,259 N673S possibly damaging Het
Gm12185 T C 11: 48,916,023 S114G possibly damaging Het
Hsfy2 A T 1: 56,637,151 F76I probably benign Het
Igsf9b A G 9: 27,345,890 D1413G probably benign Het
Klk8 G A 7: 43,802,179 C198Y probably damaging Het
Lama3 G T 18: 12,531,834 probably null Het
Lce3f A T 3: 92,993,096 S75C unknown Het
Ldhal6b T C 17: 5,417,991 M223V probably benign Het
Magoh T C 4: 107,887,212 V126A possibly damaging Het
Mc1r A T 8: 123,408,293 I262F probably damaging Het
Mecom A G 3: 29,956,442 I629T probably damaging Het
Mkrn2os A G 6: 115,586,726 V116A possibly damaging Het
Muc5b T A 7: 141,861,729 V2804D possibly damaging Het
Myo15 T C 11: 60,488,811 V279A Het
Nhlrc2 A G 19: 56,594,896 I600V probably benign Het
Nipbl T C 15: 8,305,872 Q2183R probably benign Het
Obscn C T 11: 59,000,299 E7136K unknown Het
Olfr1118 T C 2: 87,309,509 V260A probably benign Het
Olfr25 A C 9: 38,330,224 L209F possibly damaging Het
Olfr481 T A 7: 108,081,546 F251I probably damaging Het
Olfr970 C T 9: 39,820,287 T216I probably benign Het
Otop3 T C 11: 115,339,720 I141T possibly damaging Het
Pde4dip C A 3: 97,715,565 V1443F possibly damaging Het
Pdgfra T C 5: 75,166,721 V193A probably benign Het
Phf3 T C 1: 30,805,501 Y1459C probably benign Het
Pias4 A T 10: 81,158,026 probably null Het
Plcg2 A G 8: 117,558,113 N159S probably benign Het
Plekha7 T C 7: 116,164,446 D307G probably benign Het
Ptprd T C 4: 76,072,003 K491E probably benign Het
Rbpjl A T 2: 164,405,814 R62S probably benign Het
Rgs11 T C 17: 26,207,441 S245P probably damaging Het
Ripor3 G A 2: 167,984,570 A685V possibly damaging Het
Rnase9 G A 14: 51,039,483 P13S possibly damaging Het
Scin C T 12: 40,124,589 C165Y probably damaging Het
Senp7 T C 16: 56,111,637 W100R probably benign Het
Slc26a2 T C 18: 61,198,460 D633G probably benign Het
Slc4a4 C T 5: 89,135,686 P446S probably damaging Het
Soga3 A T 10: 29,148,228 D380V probably damaging Het
Spag17 T A 3: 100,095,595 C1878* probably null Het
Ssc5d A G 7: 4,927,576 E129G possibly damaging Het
Supt6 T C 11: 78,226,951 N480D probably benign Het
Tbk1 A G 10: 121,552,501 L590S probably damaging Het
Tex45 A T 8: 3,476,057 H70L probably benign Het
Tmem63a T A 1: 180,952,974 probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Trio A G 15: 27,912,642 S109P unknown Het
Tsga10 A T 1: 37,804,893 probably null Het
Ttn A T 2: 76,795,763 L14984* probably null Het
Tyr T C 7: 87,483,884 T325A probably benign Het
U2surp A T 9: 95,485,679 probably null Het
Uba6 C A 5: 86,147,075 K368N probably benign Het
Upb1 A G 10: 75,436,201 T283A probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn1r31 A G 6: 58,472,470 Y137H probably damaging Het
Wdtc1 T C 4: 133,296,437 K541R probably damaging Het
Wrn A G 8: 33,310,713 I624T possibly damaging Het
Zfp804b T A 5: 6,770,066 D999V possibly damaging Het
Zmym4 T A 4: 126,925,795 H105L probably benign Het
Other mutations in Ankrd39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Ankrd39 APN 1 36542061 missense probably damaging 0.98
R1637:Ankrd39 UTSW 1 36539492 nonsense probably null
R4249:Ankrd39 UTSW 1 36547155 missense probably benign 0.00
R5548:Ankrd39 UTSW 1 36541981 missense probably damaging 1.00
R5551:Ankrd39 UTSW 1 36541981 missense probably damaging 1.00
R5552:Ankrd39 UTSW 1 36541981 missense probably damaging 1.00
R5553:Ankrd39 UTSW 1 36541981 missense probably damaging 1.00
R5554:Ankrd39 UTSW 1 36541981 missense probably damaging 1.00
R5591:Ankrd39 UTSW 1 36541981 missense probably damaging 1.00
R5594:Ankrd39 UTSW 1 36541981 missense probably damaging 1.00
Z1176:Ankrd39 UTSW 1 36542005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCAGACTCACAAGCCTTCAG -3'
(R):5'- AAAGTGCAGGTACCAGCTTGG -3'

Sequencing Primer
(F):5'- GCTCTTCTGGGCAATCTGGC -3'
(R):5'- AGGGTCACGAGGACATTT -3'
Posted On2019-10-24