Incidental Mutation 'R7694:Cyp26a1'
ID593580
Institutional Source Beutler Lab
Gene Symbol Cyp26a1
Ensembl Gene ENSMUSG00000024987
Gene Namecytochrome P450, family 26, subfamily a, polypeptide 1
SynonymsCyp26, P450RA, P450RAI, retinoic acid hydrolase, RAH
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7694 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location37697808-37701528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37701064 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 403 (D403N)
Ref Sequence ENSEMBL: ENSMUSP00000025946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025946]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025946
AA Change: D403N

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025946
Gene: ENSMUSG00000024987
AA Change: D403N

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:p450 45 487 2.4e-68 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein acts on retinoids, including all-trans-retinoic acid (RA), with both 4-hydroxylation and 18-hydroxylation activities. This enzyme regulates the cellular level of retinoic acid which is involved in regulation of gene expression in both embryonic and adult tissues. Two alternatively spliced transcript variants of this gene, which encode the distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die during mid-late gestation and exhibit spina bifida, caudal agenesis, and abnormalities of the kidneys, urogenital tract, hindgut, cervical vertebrae, and rostral hindbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T G 17: 13,888,882 S1571A probably damaging Het
Agbl1 C A 7: 76,698,765 A870D unknown Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Ankrd55 T C 13: 112,367,964 Y415H probably damaging Het
Cd69 G A 6: 129,270,045 R111C possibly damaging Het
Cdh26 A T 2: 178,460,103 T172S probably damaging Het
Cflar T A 1: 58,752,807 V423E Het
Cgrrf1 A C 14: 46,853,958 Q313P possibly damaging Het
Chga G A 12: 102,561,347 A87T probably benign Het
Chrna4 T A 2: 181,018,593 D102V Het
Cpvl A T 6: 53,932,517 Y211* probably null Het
Dchs2 T C 3: 83,129,482 L512P probably damaging Het
Dll3 A C 7: 28,301,745 M1R probably null Het
Dnah12 A G 14: 26,781,380 T1564A probably damaging Het
Efhb A G 17: 53,400,808 S776P probably damaging Het
Eml5 T C 12: 98,792,563 S1831G probably damaging Het
Fat1 G T 8: 44,988,930 probably null Het
Fhad1 T C 4: 141,905,064 K1255E probably benign Het
Fitm2 C T 2: 163,469,972 C107Y probably damaging Het
Gdpd4 T C 7: 97,971,939 V153A probably benign Het
Ggnbp2 A G 11: 84,860,713 V87A possibly damaging Het
Glb1l G T 1: 75,201,792 A334E probably damaging Het
Gnas T G 2: 174,300,212 L784R probably damaging Het
Gtf2i C T 5: 134,282,805 E223K probably damaging Het
H2-M10.5 T C 17: 36,773,749 Y122H probably damaging Het
Hikeshi G A 7: 89,930,346 Q6* probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Irak2 A C 6: 113,690,898 D528A probably damaging Het
Lcn2 A G 2: 32,388,030 C17R unknown Het
Lcp2 G T 11: 34,050,924 V36L probably benign Het
Lin7c T C 2: 109,896,272 S89P probably benign Het
Lrrc37a C T 11: 103,504,378 A74T probably benign Het
Lrrtm3 T A 10: 64,088,039 M450L probably benign Het
Lsm11 C T 11: 45,933,941 R253Q probably benign Het
Map9 A T 3: 82,358,983 probably benign Het
Mmp2 T A 8: 92,831,730 D142E possibly damaging Het
Nrn1l A T 8: 105,894,798 T127S probably damaging Het
Olfr310 T C 7: 86,269,775 T5A probably damaging Het
Pelp1 G A 11: 70,394,759 T761I probably damaging Het
Pmm2 T A 16: 8,645,390 V63E probably damaging Het
Ptprb T A 10: 116,372,948 L1942H probably damaging Het
Ptprk T A 10: 28,589,370 C1350S possibly damaging Het
Rnf44 A G 13: 54,682,028 V381A probably damaging Het
Robo3 G A 9: 37,418,520 P1167S probably benign Het
Ryk A G 9: 102,898,780 E489G probably damaging Het
Satb2 T A 1: 56,871,524 I321L probably benign Het
Sh2b1 A T 7: 126,467,757 V655E probably benign Het
Slc16a12 G A 19: 34,670,635 T486M probably damaging Het
Slc34a1 G T 13: 55,413,408 R562L probably benign Het
Slc4a9 A G 18: 36,536,849 E779G probably damaging Het
Strc C A 2: 121,377,096 C598F probably damaging Het
Stxbp6 A T 12: 44,902,027 F100I probably damaging Het
Tap2 A G 17: 34,205,697 T135A probably benign Het
Tmcc1 G A 6: 116,133,844 P159S Het
Tmem106b T A 6: 13,078,106 M100K probably benign Het
Ttn T A 2: 76,747,695 T24285S probably damaging Het
Vmn1r116 G A 7: 20,872,412 V53M possibly damaging Het
Zar1 A T 5: 72,580,850 S70T probably benign Het
Zfp235 C T 7: 24,142,100 T648M probably benign Het
Zfp937 C T 2: 150,239,348 H433Y probably damaging Het
Other mutations in Cyp26a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Cyp26a1 APN 19 37700002 missense probably benign 0.00
IGL01398:Cyp26a1 APN 19 37697947 missense probably damaging 1.00
IGL01624:Cyp26a1 APN 19 37698333 missense possibly damaging 0.94
IGL02398:Cyp26a1 APN 19 37700019 missense probably benign
IGL02437:Cyp26a1 APN 19 37698495 missense probably benign
IGL02709:Cyp26a1 APN 19 37699978 missense probably damaging 1.00
IGL02712:Cyp26a1 APN 19 37699978 missense probably damaging 1.00
R0834:Cyp26a1 UTSW 19 37699957 missense probably damaging 0.96
R1517:Cyp26a1 UTSW 19 37698860 missense probably benign
R1696:Cyp26a1 UTSW 19 37701178 missense probably benign 0.02
R1831:Cyp26a1 UTSW 19 37700623 missense probably damaging 0.98
R2040:Cyp26a1 UTSW 19 37698051 missense possibly damaging 0.46
R2504:Cyp26a1 UTSW 19 37698342 missense probably damaging 1.00
R4693:Cyp26a1 UTSW 19 37698477 missense probably benign 0.11
R4808:Cyp26a1 UTSW 19 37701125 missense probably benign
R5124:Cyp26a1 UTSW 19 37701217 missense probably benign 0.01
R5412:Cyp26a1 UTSW 19 37701182 missense probably damaging 1.00
R5964:Cyp26a1 UTSW 19 37699962 missense probably damaging 1.00
R6355:Cyp26a1 UTSW 19 37698929 missense possibly damaging 0.46
R6426:Cyp26a1 UTSW 19 37699305 missense probably benign 0.14
R6501:Cyp26a1 UTSW 19 37699070 missense possibly damaging 0.80
R6734:Cyp26a1 UTSW 19 37701212 missense probably damaging 1.00
R7019:Cyp26a1 UTSW 19 37698812 missense probably damaging 1.00
R7188:Cyp26a1 UTSW 19 37699305 missense possibly damaging 0.64
R7667:Cyp26a1 UTSW 19 37700624 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCACTGCCCTTGACAGTGTC -3'
(R):5'- TTAGAAGCTGCCAATCACAGTG -3'

Sequencing Primer
(F):5'- TGCCTCCTATGGTACTGGGAAC -3'
(R):5'- GCTGCCAATCACAGTGCCTAG -3'
Posted On2019-11-12