Incidental Mutation 'R7707:Gorab'
ID594311
Institutional Source Beutler Lab
Gene Symbol Gorab
Ensembl Gene ENSMUSG00000040124
Gene Namegolgin, RAB6-interacting
SynonymsNTKL-BP1, Scyl1bp1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R7707 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location163384908-163403669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 163392440 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 211 (D211G)
Ref Sequence ENSEMBL: ENSMUSP00000036253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045138] [ENSMUST00000186402]
Predicted Effect probably damaging
Transcript: ENSMUST00000045138
AA Change: D211G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036253
Gene: ENSMUSG00000040124
AA Change: D211G

DomainStartEndE-ValueType
Pfam:Transcrip_act 128 276 9.3e-11 PFAM
low complexity region 277 301 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186402
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the golgin family, a group of coiled-coil proteins localized to the Golgi. The encoded protein may function in the secretory pathway. The encoded protein, which also localizes to the cytoplasm, was identified by interactions with the N-terminal kinase-like protein, and thus it may function in mitosis. Mutations in this gene have been associated with geroderma osteodysplastica. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null gene trap allele exhibit hunched posture, craniofacial abnormalities, neonatal lethality, respiratory distress, skin edema, decreased hair follicles, fewer dermal condensates and papillae, and impaired formation of primary cilia on dermal condensate cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610044O15Rik8 A T 8: 129,219,179 C388* probably null Het
2900026A02Rik T A 5: 113,137,986 M1L probably benign Het
Ap1s3 T C 1: 79,614,247 K129E probably benign Het
Ap3b2 C T 7: 81,476,782 V357I possibly damaging Het
Aplp1 A T 7: 30,443,098 C140S probably damaging Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Asb4 A G 6: 5,430,968 H401R probably benign Het
Bpi A T 2: 158,261,173 E79D probably benign Het
Cant1 C T 11: 118,410,898 V198M possibly damaging Het
Casp9 C T 4: 141,805,467 R225C probably benign Het
Ccdc88b C A 19: 6,857,469 R82L probably benign Het
Chrm4 A G 2: 91,927,354 T36A probably benign Het
Cntln A T 4: 84,884,616 D51V probably damaging Het
Commd8 A T 5: 72,162,738 F120Y probably damaging Het
Cpne6 A C 14: 55,516,314 T410P probably damaging Het
Ctnnb1 A T 9: 120,952,865 I315F possibly damaging Het
Dnah9 A G 11: 66,118,958 V701A probably damaging Het
Efcab9 A G 11: 32,522,851 Y199H possibly damaging Het
Endou T A 15: 97,713,102 probably null Het
Fam160a1 A G 3: 85,676,253 V412A probably benign Het
Foxc2 C T 8: 121,117,902 P430S probably benign Het
Gas2l3 T A 10: 89,414,358 K299N probably damaging Het
Gm10375 G A 14: 43,604,875 Q133* probably null Het
Grin3b T A 10: 79,975,901 S747T possibly damaging Het
Gucd1 C A 10: 75,511,286 probably benign Het
Gucy2d T C 7: 98,451,669 F400L possibly damaging Het
Hivep3 G A 4: 119,733,959 V55M Het
Igsf3 A G 3: 101,459,922 N1157S probably benign Het
Irak3 A T 10: 120,146,584 D324E probably damaging Het
Jup G T 11: 100,383,052 A221D possibly damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lgr4 A G 2: 109,997,591 probably null Het
Lrrc34 T C 3: 30,624,892 D352G probably benign Het
Metrn C A 17: 25,795,410 A175S probably benign Het
Nr2c1 T A 10: 94,188,165 S411T probably benign Het
Olfr1206 A G 2: 88,864,809 D68G possibly damaging Het
Olfr190 T A 16: 59,074,271 I270F possibly damaging Het
Orc3 T A 4: 34,598,691 K172* probably null Het
Oxnad1 A G 14: 32,102,008 probably null Het
Pcdh7 A G 5: 57,720,330 N409S probably damaging Het
Pcdha11 A T 18: 37,011,792 N312I probably benign Het
Pds5a G T 5: 65,610,133 P121Q unknown Het
Phc1 A G 6: 122,323,780 I380T unknown Het
Phldb3 C A 7: 24,626,597 H535N possibly damaging Het
Proser3 T C 7: 30,539,791 Q600R probably benign Het
Ptprz1 A G 6: 23,002,296 M1462V probably benign Het
Pyroxd2 T C 19: 42,738,147 T243A probably damaging Het
Ralgapa1 C A 12: 55,777,292 D268Y probably null Het
Rapgef5 A C 12: 117,715,344 Y419S probably damaging Het
Rbm24 C A 13: 46,429,129 Q175K possibly damaging Het
Robo4 A T 9: 37,413,122 D982V probably damaging Het
Sbf2 T C 7: 110,330,713 probably null Het
Serping1 A T 2: 84,773,699 probably null Het
Shank1 C T 7: 44,344,301 S798F unknown Het
Slc15a5 A T 6: 138,079,747 M57K probably damaging Het
Slc35g1 T A 19: 38,403,123 C284* probably null Het
Src G A 2: 157,464,658 D194N probably damaging Het
Srfbp1 A G 18: 52,483,654 T84A probably damaging Het
Sspo A T 6: 48,461,527 T1510S probably benign Het
Taar1 A T 10: 23,921,237 I278F possibly damaging Het
Taf1a T C 1: 183,404,429 Y281H possibly damaging Het
Thbs3 A T 3: 89,224,900 Y798F possibly damaging Het
Tnpo1 T C 13: 98,890,787 T7A probably benign Het
Traf7 A T 17: 24,510,709 probably null Het
Trbv19 G A 6: 41,178,613 V9I possibly damaging Het
Trim17 C T 11: 58,965,284 Q56* probably null Het
Ttn G T 2: 76,902,062 A4643E unknown Het
Ugt2b36 A G 5: 87,081,508 probably null Het
Uso1 A G 5: 92,201,936 *960W probably null Het
Usp2 G T 9: 44,073,460 probably null Het
Wdr20rt A G 12: 65,226,207 D148G probably damaging Het
Wdr66 A T 5: 123,253,887 E28V probably benign Het
Wif1 T C 10: 121,083,959 F204L probably damaging Het
Wwp1 T C 4: 19,627,645 D750G probably benign Het
Zmynd12 A T 4: 119,444,866 D234V probably damaging Het
Other mutations in Gorab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gorab APN 1 163394687 missense probably damaging 1.00
IGL00915:Gorab APN 1 163396857 missense probably benign 0.00
IGL01645:Gorab APN 1 163386431 missense possibly damaging 0.46
R0387:Gorab UTSW 1 163396834 missense probably benign 0.20
R0504:Gorab UTSW 1 163386605 missense probably damaging 1.00
R0612:Gorab UTSW 1 163397169 missense possibly damaging 0.93
R1863:Gorab UTSW 1 163403562 missense probably damaging 1.00
R1991:Gorab UTSW 1 163397056 missense probably damaging 0.99
R1992:Gorab UTSW 1 163397056 missense probably damaging 0.99
R2844:Gorab UTSW 1 163396806 splice site probably null
R4039:Gorab UTSW 1 163397066 missense possibly damaging 0.65
R4527:Gorab UTSW 1 163397136 missense possibly damaging 0.94
R4864:Gorab UTSW 1 163386398 missense probably benign
R5175:Gorab UTSW 1 163386645 missense probably damaging 1.00
R5470:Gorab UTSW 1 163392509 missense probably damaging 1.00
R5485:Gorab UTSW 1 163386302 missense possibly damaging 0.55
R6265:Gorab UTSW 1 163386630 missense possibly damaging 0.54
R6314:Gorab UTSW 1 163397089 missense probably damaging 1.00
R6355:Gorab UTSW 1 163386569 missense probably damaging 1.00
Z1088:Gorab UTSW 1 163386323 missense possibly damaging 0.56
Z1088:Gorab UTSW 1 163403550 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAAGCTATAGGACAGGTGGCC -3'
(R):5'- GCACAGGGCATTATTTTGTCTC -3'

Sequencing Primer
(F):5'- GGCCACTTGAGTTAGCACATTACTG -3'
(R):5'- CACAGGGCATTATTTTGTCTCAATTC -3'
Posted On2019-11-12