Incidental Mutation 'R7794:Poc1b'
ID600131
Institutional Source Beutler Lab
Gene Symbol Poc1b
Ensembl Gene ENSMUSG00000019952
Gene NamePOC1 centriolar protein B
Synonyms4933430F16Rik, Wdr51b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7794 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location99107036-99198074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99129598 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 130 (S130G)
Ref Sequence ENSEMBL: ENSMUSP00000020113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020113] [ENSMUST00000060761] [ENSMUST00000159043] [ENSMUST00000159228] [ENSMUST00000159990] [ENSMUST00000219884]
AlphaFold Q8BHD1
Predicted Effect possibly damaging
Transcript: ENSMUST00000020113
AA Change: S130G

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020113
Gene: ENSMUSG00000019952
AA Change: S130G

DomainStartEndE-ValueType
WD40 7 46 1.71e-7 SMART
WD40 49 88 8.68e-9 SMART
WD40 91 130 2.71e-10 SMART
WD40 133 172 2.43e-12 SMART
WD40 175 214 2.07e-6 SMART
WD40 217 256 1.71e-7 SMART
WD40 259 298 7.55e-9 SMART
coiled coil region 428 468 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000060761
Predicted Effect probably benign
Transcript: ENSMUST00000159043
AA Change: S38G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000123719
Gene: ENSMUSG00000019952
AA Change: S38G

DomainStartEndE-ValueType
WD40 2 38 5.95e-7 SMART
Blast:WD40 41 75 9e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000159228
AA Change: S130G

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124144
Gene: ENSMUSG00000019952
AA Change: S130G

DomainStartEndE-ValueType
WD40 7 46 1.71e-7 SMART
WD40 49 88 8.68e-9 SMART
WD40 91 130 2.71e-10 SMART
WD40 133 172 2.43e-12 SMART
WD40 175 214 2.07e-6 SMART
WD40 217 256 1.71e-7 SMART
WD40 259 298 7.55e-9 SMART
coiled coil region 401 441 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159990
AA Change: S88G

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125423
Gene: ENSMUSG00000019952
AA Change: S88G

DomainStartEndE-ValueType
WD40 7 46 8.68e-9 SMART
WD40 49 88 2.71e-10 SMART
WD40 91 130 2.43e-12 SMART
WD40 133 172 2.07e-6 SMART
WD40 175 214 1.71e-7 SMART
WD40 217 256 7.55e-9 SMART
coiled coil region 386 426 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000219884
AA Change: S130G

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] POC1 proteins contain an N-terminal WD40 domain and a C-terminal coiled coil domain and are part of centrosomes. They play an important role in basal body and cilia formation. This gene encodes one of the two POC1 proteins found in humans. Mutation in this gene result in autosomal-recessive cone-rod dystrophy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,286,678 M542K possibly damaging Het
Abcc3 T A 11: 94,358,871 I1083F probably benign Het
Acsm5 A G 7: 119,538,129 probably benign Het
Acyp1 G T 12: 85,288,279 A22E probably benign Het
Afdn C A 17: 13,882,433 A1090E probably damaging Het
Ahdc1 T G 4: 133,063,978 D843E possibly damaging Het
Bahcc1 G T 11: 120,272,681 E602* probably null Het
Bora A G 14: 99,072,644 T470A possibly damaging Het
Bzw1 T A 1: 58,400,800 S166T probably benign Het
Car13 A G 3: 14,654,888 H120R probably damaging Het
Cstf3 G A 2: 104,590,581 ⇒1 probably benign Het
Dip2a T C 10: 76,276,625 N1080D probably damaging Het
Dis3 A G 14: 99,098,797 L91P probably benign Het
E2f6 A G 12: 16,820,369 D174G possibly damaging Het
Emsy A T 7: 98,600,724 S785R probably benign Het
Fbxl17 A G 17: 63,356,811 I561T probably damaging Het
Gabra6 A T 11: 42,321,041 probably null Het
Gm47996 C G 1: 151,210,794 P209A possibly damaging Het
Gm8765 C G 13: 50,702,308 P661A probably damaging Het
Hcls1 A G 16: 36,962,064 E365G probably damaging Het
Hoxa6 T A 6: 52,206,568 T166S possibly damaging Het
Hydin A G 8: 110,509,083 Y1900C probably damaging Het
I0C0044D17Rik T C 4: 98,820,345 probably benign Het
Ifitm7 T C 16: 13,983,746 T50A probably benign Het
Igkv10-95 A G 6: 68,680,827 Q109R possibly damaging Het
Il1rap A T 16: 26,722,908 H633L probably benign Het
Ippk C T 13: 49,446,342 P226S Het
Kmt2e G A 5: 23,464,716 G67D probably damaging Het
Kpna6 T C 4: 129,648,051 T518A probably benign Het
March11 A G 15: 26,409,198 I328V probably benign Het
Mbtps1 A G 8: 119,538,884 I308T probably damaging Het
Mug1 A T 6: 121,856,288 D284V possibly damaging Het
Myo16 A G 8: 10,569,913 K1488R unknown Het
Myom2 G A 8: 15,083,259 G384R probably damaging Het
Naa16 A G 14: 79,377,494 Y189H probably damaging Het
Nav3 G A 10: 109,688,856 A2304V probably benign Het
Olfr1145 T A 2: 87,810,474 V218E probably damaging Het
Olfr126 A T 17: 37,850,787 Q65L probably benign Het
Olfr310 T A 7: 86,269,133 I219L probably damaging Het
Orc5 A T 5: 22,533,784 Y160N possibly damaging Het
Pan2 T C 10: 128,316,527 probably null Het
Pcdhb20 A G 18: 37,504,432 R4G probably benign Het
Psme2b A G 11: 48,945,856 V88A probably benign Het
Ptpn13 C T 5: 103,492,224 T183M probably benign Het
Ptpn4 T C 1: 119,726,037 E275G probably damaging Het
Rab21 A T 10: 115,298,857 L119* probably null Het
Rep15 T A 6: 147,033,140 I159N probably damaging Het
Rps6kc1 T C 1: 190,783,628 E967G probably benign Het
Rptn G A 3: 93,395,729 R123K probably benign Het
Scn11a A T 9: 119,765,514 V1271D probably damaging Het
Scn5a A T 9: 119,529,087 I696N probably damaging Het
Slc25a12 T C 2: 71,311,508 E267G probably damaging Het
Slc5a4b A T 10: 76,062,299 M527K probably benign Het
Speg T A 1: 75,388,870 S632T probably benign Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Synrg G T 11: 84,019,574 M933I probably benign Het
Tmem178b A T 6: 40,245,617 I89F probably damaging Het
Tyr C T 7: 87,483,820 probably null Het
Usp30 T A 5: 114,112,972 C237* probably null Het
Xpo6 G T 7: 126,160,863 T188K probably damaging Het
Zfp382 G A 7: 30,131,610 S108N possibly damaging Het
Zfp820 A C 17: 21,820,128 V73G probably damaging Het
Other mutations in Poc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Poc1b APN 10 99129652 missense probably benign 0.29
IGL01314:Poc1b APN 10 99129641 missense probably damaging 1.00
IGL02503:Poc1b APN 10 99144348 splice site probably benign
IGL02839:Poc1b APN 10 99144598 splice site probably benign
IGL02966:Poc1b APN 10 99144314 missense probably damaging 1.00
R0708:Poc1b UTSW 10 99155130 missense probably null 0.99
R0723:Poc1b UTSW 10 99129595 missense probably damaging 1.00
R1423:Poc1b UTSW 10 99152863 missense probably damaging 1.00
R4383:Poc1b UTSW 10 99156299 missense probably damaging 1.00
R4426:Poc1b UTSW 10 99155139 critical splice donor site probably null
R4427:Poc1b UTSW 10 99155139 critical splice donor site probably null
R5076:Poc1b UTSW 10 99107841 missense probably damaging 0.98
R6355:Poc1b UTSW 10 99129574 missense probably damaging 1.00
R6731:Poc1b UTSW 10 99152871 missense probably null 1.00
R6833:Poc1b UTSW 10 99192804 missense probably benign 0.16
R6834:Poc1b UTSW 10 99192804 missense probably benign 0.16
R7184:Poc1b UTSW 10 99134337 missense probably benign 0.01
R7982:Poc1b UTSW 10 99164902 missense probably benign 0.28
R8172:Poc1b UTSW 10 99144476 splice site probably null
R8182:Poc1b UTSW 10 99155143 splice site probably null
R8544:Poc1b UTSW 10 99124908 nonsense probably null
R8679:Poc1b UTSW 10 99164866 splice site probably benign
R8772:Poc1b UTSW 10 99156357 splice site probably benign
R8931:Poc1b UTSW 10 99192999 critical splice donor site probably null
R9021:Poc1b UTSW 10 99144321 missense possibly damaging 0.50
Z1177:Poc1b UTSW 10 99144513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACTACTGCGTGGTGACTG -3'
(R):5'- AGGAAGCAGTGGCCATACC -3'

Sequencing Primer
(F):5'- GCGTGGTGACTGAATATTAAATTAAC -3'
(R):5'- TCTAGAGCGTAACCTGCATG -3'
Posted On2019-11-26