Incidental Mutation 'R1423:Poc1b'
ID161173
Institutional Source Beutler Lab
Gene Symbol Poc1b
Ensembl Gene ENSMUSG00000019952
Gene NamePOC1 centriolar protein B
Synonyms4933430F16Rik, Wdr51b
MMRRC Submission 039479-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1423 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location99107036-99198074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99152863 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 247 (S247P)
Ref Sequence ENSEMBL: ENSMUSP00000124144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020113] [ENSMUST00000159043] [ENSMUST00000159228] [ENSMUST00000159990] [ENSMUST00000219884]
Predicted Effect probably damaging
Transcript: ENSMUST00000020113
AA Change: S247P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020113
Gene: ENSMUSG00000019952
AA Change: S247P

DomainStartEndE-ValueType
WD40 7 46 1.71e-7 SMART
WD40 49 88 8.68e-9 SMART
WD40 91 130 2.71e-10 SMART
WD40 133 172 2.43e-12 SMART
WD40 175 214 2.07e-6 SMART
WD40 217 256 1.71e-7 SMART
WD40 259 298 7.55e-9 SMART
coiled coil region 428 468 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159043
SMART Domains Protein: ENSMUSP00000123719
Gene: ENSMUSG00000019952

DomainStartEndE-ValueType
WD40 2 38 5.95e-7 SMART
Blast:WD40 41 75 9e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159228
AA Change: S247P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124144
Gene: ENSMUSG00000019952
AA Change: S247P

DomainStartEndE-ValueType
WD40 7 46 1.71e-7 SMART
WD40 49 88 8.68e-9 SMART
WD40 91 130 2.71e-10 SMART
WD40 133 172 2.43e-12 SMART
WD40 175 214 2.07e-6 SMART
WD40 217 256 1.71e-7 SMART
WD40 259 298 7.55e-9 SMART
coiled coil region 401 441 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159990
AA Change: S205P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125423
Gene: ENSMUSG00000019952
AA Change: S205P

DomainStartEndE-ValueType
WD40 7 46 8.68e-9 SMART
WD40 49 88 2.71e-10 SMART
WD40 91 130 2.43e-12 SMART
WD40 133 172 2.07e-6 SMART
WD40 175 214 1.71e-7 SMART
WD40 217 256 7.55e-9 SMART
coiled coil region 386 426 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219884
AA Change: S247P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.7925 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] POC1 proteins contain an N-terminal WD40 domain and a C-terminal coiled coil domain and are part of centrosomes. They play an important role in basal body and cilia formation. This gene encodes one of the two POC1 proteins found in humans. Mutation in this gene result in autosomal-recessive cone-rod dystrophy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,439 E691G probably damaging Het
Ankrd13d A G 19: 4,281,069 S64P probably damaging Het
Bag4 T C 8: 25,768,274 S342G probably damaging Het
Bbs1 G A 19: 4,894,263 T446I probably benign Het
Bmyc A G 2: 25,707,224 D100G probably damaging Het
Btbd7 T C 12: 102,785,475 D1010G possibly damaging Het
Celsr3 A T 9: 108,826,905 T196S probably benign Het
Crtam C A 9: 40,973,622 R161L probably benign Het
Cyp11b2 C A 15: 74,853,130 G290V probably damaging Het
Edc4 C T 8: 105,891,211 probably benign Het
Exd1 A T 2: 119,540,013 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxo16 T C 14: 65,287,174 probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gabrb2 A G 11: 42,529,471 N173S probably damaging Het
Gm13741 A T 2: 87,656,330 I197K possibly damaging Het
Helb T A 10: 120,108,966 I222F probably damaging Het
Hesx1 A T 14: 27,001,919 Q153L probably null Het
Isca1 T C 13: 59,762,779 N33S probably benign Het
Itsn2 T C 12: 4,673,572 V1142A probably damaging Het
Lama5 T G 2: 180,195,641 T984P probably damaging Het
Lima1 T A 15: 99,819,745 K127* probably null Het
Lmbrd1 T A 1: 24,746,878 V418D probably damaging Het
Mertk T C 2: 128,778,963 V575A probably damaging Het
Mkl2 T C 16: 13,412,241 V930A possibly damaging Het
Mrps28 T C 3: 8,900,124 H85R probably benign Het
Naip2 TCCC TCC 13: 100,154,847 probably benign Het
Naip2 G A 13: 100,154,872 S1186F possibly damaging Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nhlrc3 A T 3: 53,462,415 L45H probably damaging Het
Olfr285 T C 15: 98,313,443 T36A probably damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr678 T G 7: 105,070,019 M184R probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdhb15 A T 18: 37,473,922 D69V probably damaging Het
Pitpnm1 G A 19: 4,112,392 R1074H probably damaging Het
Plb1 A G 5: 32,293,257 N381D probably benign Het
Prl7b1 T A 13: 27,602,127 N186I probably damaging Het
Riok1 T C 13: 38,049,114 M241T probably damaging Het
Tigit T C 16: 43,649,032 E232G probably benign Het
Tpst2 T A 5: 112,307,622 L9Q probably benign Het
Ttbk1 T C 17: 46,446,154 probably benign Het
Vmn1r3 A T 4: 3,185,231 N25K probably damaging Het
Vmn2r121 T A X: 124,129,905 H522L possibly damaging Het
Vmn2r15 T C 5: 109,293,227 Y255C probably damaging Het
Other mutations in Poc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Poc1b APN 10 99129652 missense probably benign 0.29
IGL01314:Poc1b APN 10 99129641 missense probably damaging 1.00
IGL02503:Poc1b APN 10 99144348 splice site probably benign
IGL02839:Poc1b APN 10 99144598 splice site probably benign
IGL02966:Poc1b APN 10 99144314 missense probably damaging 1.00
R0708:Poc1b UTSW 10 99155130 missense probably null 0.99
R0723:Poc1b UTSW 10 99129595 missense probably damaging 1.00
R4383:Poc1b UTSW 10 99156299 missense probably damaging 1.00
R4426:Poc1b UTSW 10 99155139 critical splice donor site probably null
R4427:Poc1b UTSW 10 99155139 critical splice donor site probably null
R5076:Poc1b UTSW 10 99107841 missense probably damaging 0.98
R6355:Poc1b UTSW 10 99129574 missense probably damaging 1.00
R6731:Poc1b UTSW 10 99152871 missense probably null 1.00
R6833:Poc1b UTSW 10 99192804 missense probably benign 0.16
R6834:Poc1b UTSW 10 99192804 missense probably benign 0.16
R7184:Poc1b UTSW 10 99134337 missense probably benign 0.01
R7794:Poc1b UTSW 10 99129598 missense possibly damaging 0.67
R7982:Poc1b UTSW 10 99164902 missense probably benign 0.28
R8172:Poc1b UTSW 10 99144476 splice site probably null
R8182:Poc1b UTSW 10 99155143 splice site probably null
Z1177:Poc1b UTSW 10 99144513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGTTTTCACAGTGATGCTGCC -3'
(R):5'- GGTCCCTGCACAAGAATTACCAGAG -3'

Sequencing Primer
(F):5'- CAGTGATGCTGCCAACATAG -3'
(R):5'- CAATTTGGTCTGTACTGAGACTGC -3'
Posted On2014-03-14