Incidental Mutation 'R7840:Upp2'
ID606195
Institutional Source Beutler Lab
Gene Symbol Upp2
Ensembl Gene ENSMUSG00000026839
Gene Nameuridine phosphorylase 2
SynonymsUDRPASE2, UP2, UPASE2, 1700124F02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R7840 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location58567298-58792971 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) G to T at 58774115 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000060437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059102] [ENSMUST00000071543] [ENSMUST00000102755] [ENSMUST00000229923] [ENSMUST00000230627]
Predicted Effect probably null
Transcript: ENSMUST00000059102
SMART Domains Protein: ENSMUSP00000060437
Gene: ENSMUSG00000026839

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 78 328 6.4e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000071543
SMART Domains Protein: ENSMUSP00000071474
Gene: ENSMUSG00000026839

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:PNP_UDP_1 98 316 7.1e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102755
SMART Domains Protein: ENSMUSP00000099816
Gene: ENSMUSG00000026839

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 60 310 4.2e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000229923
Predicted Effect probably null
Transcript: ENSMUST00000230627
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik A G 2: 132,750,590 T186A probably damaging Het
Abca16 A G 7: 120,475,466 N577S probably benign Het
Ang4 A G 14: 51,764,072 S140P probably damaging Het
Ankdd1b T C 13: 96,419,798 probably null Het
Anln G T 9: 22,362,723 A606D probably benign Het
Ano5 T G 7: 51,587,732 V768G possibly damaging Het
Ccdc180 A T 4: 45,900,461 Y275F possibly damaging Het
Chpf T C 1: 75,476,627 Y334C probably damaging Het
Chrdl2 T C 7: 100,033,656 L381S probably damaging Het
Cox20 A T 1: 178,322,561 Y100F probably benign Het
Dbn1 T C 13: 55,475,509 D433G possibly damaging Het
Dclre1a A T 19: 56,531,252 I983N probably damaging Het
Dok6 A T 18: 89,560,058 H78Q probably benign Het
Fam35a A G 14: 34,237,566 Y820H probably damaging Het
Fam92b T C 8: 120,166,633 D273G probably benign Het
Fpr1 A T 17: 17,877,372 F118L probably benign Het
Fscn3 A G 6: 28,430,176 Y115C probably damaging Het
Gabra4 A C 5: 71,640,913 probably null Het
Gm11639 G A 11: 104,733,713 D878N probably benign Het
Gm45861 T C 8: 27,582,723 V1290A unknown Het
Hivep1 T C 13: 42,155,352 V356A probably benign Het
Ikbip T C 10: 91,101,755 Y97H possibly damaging Het
Il10 A G 1: 131,020,068 T53A probably benign Het
Inpp5f T C 7: 128,694,802 V959A probably benign Het
Insr T C 8: 3,258,415 E207G probably benign Het
Kndc1 T A 7: 139,923,816 S1012T probably damaging Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Ksr2 T C 5: 117,555,264 V259A probably benign Het
Lox A T 18: 52,525,122 Y326* probably null Het
Lpin2 C A 17: 71,230,274 T272N probably benign Het
Lrp2 C T 2: 69,464,784 E3397K probably damaging Het
Megf11 G A 9: 64,695,427 C850Y possibly damaging Het
Morc1 T C 16: 48,498,784 F284L probably benign Het
Moxd2 T A 6: 40,885,444 D147V possibly damaging Het
Mrpl21 T C 19: 3,287,752 L153P probably damaging Het
Naip2 T C 13: 100,144,409 T1432A probably benign Het
Naip6 T A 13: 100,315,471 D211V probably damaging Het
Ncoa5 T C 2: 165,012,896 H102R possibly damaging Het
Ndel1 A T 11: 68,829,980 C293* probably null Het
Ninl A T 2: 150,966,096 M82K probably benign Het
Nrcam G A 12: 44,541,075 probably null Het
Nup210l A T 3: 90,122,729 I250L probably benign Het
Obscn T C 11: 59,077,950 E2532G possibly damaging Het
Olfr1062 A G 2: 86,423,239 F146L probably benign Het
Olfr110 G T 17: 37,498,977 G109C probably damaging Het
Olfr20 C A 11: 73,353,759 A2E probably benign Het
Osgin1 G A 8: 119,445,034 S189N possibly damaging Het
Otud7b A G 3: 96,155,373 E643G probably damaging Het
Phldb2 T A 16: 45,751,364 T1222S probably damaging Het
Pwp1 C T 10: 85,888,050 R472W probably damaging Het
Rad21 T C 15: 51,973,142 Y211C probably damaging Het
Rexo1 A G 10: 80,550,738 V162A probably benign Het
Rtl1 C T 12: 109,594,155 V417I probably benign Het
Setbp1 G A 18: 78,783,424 P1325S probably benign Het
Skint7 G T 4: 111,982,226 C239F probably benign Het
Slc25a1 A G 16: 17,926,274 L221P probably benign Het
Snrnp70 T A 7: 45,376,790 D385V unknown Het
Sp7 A C 15: 102,359,098 V109G probably benign Het
Syne1 A T 10: 5,132,078 Y849N probably damaging Het
Tas2r108 T C 6: 40,493,856 F89L possibly damaging Het
Tcf3 C T 10: 80,410,467 A581T possibly damaging Het
Tcrg-C1 A T 13: 19,216,521 Y140F Het
Tcta A G 9: 108,305,787 L53P probably damaging Het
Traf3ip2 C G 10: 39,626,455 Q200E probably damaging Het
Tyk2 A T 9: 21,124,967 C75S probably damaging Het
Ugt3a1 G A 15: 9,311,817 G382R probably damaging Het
Vmn1r212 A T 13: 22,883,153 F337I unknown Het
Vmn1r58 T C 7: 5,411,243 probably benign Het
Vps13d A T 4: 145,103,676 V2856D Het
Wdr37 A C 13: 8,836,875 L292R probably damaging Het
Yipf3 T C 17: 46,250,864 I199T probably benign Het
Zdhhc23 A G 16: 43,971,544 S289P possibly damaging Het
Zfp229 A T 17: 21,746,150 K454* probably null Het
Other mutations in Upp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Upp2 APN 2 58790064 missense probably benign 0.43
IGL01716:Upp2 APN 2 58790046 missense probably damaging 0.99
IGL02069:Upp2 APN 2 58771417 splice site probably benign
IGL02349:Upp2 APN 2 58777886 missense probably benign 0.03
IGL03072:Upp2 APN 2 58755423 critical splice donor site probably null
R0815:Upp2 UTSW 2 58771556 missense probably benign 0.00
R1164:Upp2 UTSW 2 58763704 missense probably damaging 1.00
R1400:Upp2 UTSW 2 58790106 missense probably damaging 1.00
R1553:Upp2 UTSW 2 58790140 missense probably damaging 1.00
R1581:Upp2 UTSW 2 58774165 missense possibly damaging 0.93
R1674:Upp2 UTSW 2 58790064 missense probably benign 0.43
R1702:Upp2 UTSW 2 58771550 missense possibly damaging 0.86
R1902:Upp2 UTSW 2 58771452 missense probably damaging 1.00
R2351:Upp2 UTSW 2 58763662 splice site probably null
R3011:Upp2 UTSW 2 58790095 missense probably damaging 0.97
R3622:Upp2 UTSW 2 58790116 missense possibly damaging 0.83
R3623:Upp2 UTSW 2 58790116 missense possibly damaging 0.83
R3731:Upp2 UTSW 2 58755367 missense probably benign 0.02
R4257:Upp2 UTSW 2 58780094 missense probably damaging 1.00
R4296:Upp2 UTSW 2 58778009 missense probably damaging 1.00
R4768:Upp2 UTSW 2 58777895 missense probably damaging 0.99
R5116:Upp2 UTSW 2 58771542 missense probably damaging 1.00
R5638:Upp2 UTSW 2 58790095 missense probably damaging 0.97
R7100:Upp2 UTSW 2 58791805 missense probably benign
R7421:Upp2 UTSW 2 58771574 missense possibly damaging 0.49
R7727:Upp2 UTSW 2 58774148 missense possibly damaging 0.95
R8033:Upp2 UTSW 2 58780059 missense probably damaging 1.00
R8359:Upp2 UTSW 2 58777943 missense probably benign 0.05
R8461:Upp2 UTSW 2 58780056 missense probably benign 0.02
R8510:Upp2 UTSW 2 58780106 missense probably damaging 1.00
Z1177:Upp2 UTSW 2 58780062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATCAGCATGCCATGTAGG -3'
(R):5'- AGCCCATCTGGATTTCTGTTG -3'

Sequencing Primer
(F):5'- GGCATCACTTAGAGATGACTTACG -3'
(R):5'- GGTATACTTTGAATTAACACGGGG -3'
Posted On2019-12-20