Incidental Mutation 'R7880:Olfr1264'
ID608677
Institutional Source Beutler Lab
Gene Symbol Olfr1264
Ensembl Gene ENSMUSG00000075069
Gene Nameolfactory receptor 1264
SynonymsGA_x6K02T2Q125-51454183-51453257, MOR236-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R7880 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location90018526-90025577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90022037 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 10 (F10I)
Ref Sequence ENSEMBL: ENSMUSP00000149126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099758] [ENSMUST00000214382] [ENSMUST00000216616] [ENSMUST00000217065]
Predicted Effect probably damaging
Transcript: ENSMUST00000099758
AA Change: F10I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097347
Gene: ENSMUSG00000075069
AA Change: F10I

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.8e-47 PFAM
Pfam:7tm_1 39 285 2.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214382
Predicted Effect probably damaging
Transcript: ENSMUST00000216616
AA Change: F10I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217065
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T A 7: 133,909,962 D703V possibly damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Akap13 A G 7: 75,586,216 T180A probably damaging Het
Arhgap31 G A 16: 38,602,725 A993V probably benign Het
Asxl3 C T 18: 22,522,151 P1073S possibly damaging Het
Bmp3 T G 5: 98,872,575 S286A probably damaging Het
Cacna2d4 C T 6: 119,349,155 S1078F probably damaging Het
Cd101 A G 3: 101,007,866 L799P probably benign Het
Chst13 C T 6: 90,325,080 R28H possibly damaging Het
CN725425 T A 15: 91,246,105 C390* probably null Het
Crabp1 C A 9: 54,765,658 C82* probably null Het
Cyp2b23 A C 7: 26,673,134 V352G probably damaging Het
Dmrta1 T A 4: 89,688,844 V179E possibly damaging Het
Ect2l T C 10: 18,136,954 D839G possibly damaging Het
Espnl A T 1: 91,344,766 E616V possibly damaging Het
Fam50b C A 13: 34,746,819 Q93K probably benign Het
Focad C T 4: 88,401,170 R1539C unknown Het
Gm14443 T A 2: 175,169,370 I428L probably benign Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm7030 T A 17: 36,127,869 H210L possibly damaging Het
Gramd1c C G 16: 43,992,076 A193P probably benign Het
Gsn A G 2: 35,283,927 H54R probably damaging Het
Gucy2g T A 19: 55,206,280 I902F probably damaging Het
Heg1 T C 16: 33,719,509 S280P possibly damaging Het
Herc1 G T 9: 66,508,224 R4827L probably damaging Het
Igsf21 A G 4: 140,157,508 C46R probably damaging Het
Kansl1 G T 11: 104,424,153 A353D probably damaging Het
Kcnab3 A G 11: 69,331,464 Y311C probably damaging Het
Kctd18 A G 1: 57,967,619 I24T possibly damaging Het
Lpcat4 C A 2: 112,240,031 H30N probably benign Het
Lrrc4c A G 2: 97,630,798 I590V probably benign Het
Lrrc69 T C 4: 14,703,946 I291M possibly damaging Het
Nsun6 A C 2: 14,996,379 C455W probably damaging Het
Olfr1112 T A 2: 87,192,090 C134* probably null Het
Olfr832 T G 9: 18,944,728 L27V probably benign Het
Olfr992 G T 2: 85,400,035 S166Y possibly damaging Het
Orc6 T C 8: 85,305,244 I162T probably benign Het
Pex13 A T 11: 23,649,369 S381T probably benign Het
Ppil1 G A 17: 29,261,788 H54Y probably damaging Het
Prrt4 T C 6: 29,170,156 I766V probably benign Het
Rab32 C T 10: 10,546,415 V187M probably damaging Het
Sema5a T A 15: 32,686,808 I1022N probably damaging Het
Sipa1l2 T C 8: 125,464,393 T953A probably damaging Het
Snapc3 T C 4: 83,435,194 S157P probably damaging Het
Spink5 A G 18: 43,986,326 R235G probably benign Het
Stx5a G A 19: 8,742,328 G19D probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Taf4 G A 2: 179,935,933 R532* probably null Het
Tmpo T A 10: 91,166,030 K106* probably null Het
Trnt1 T C 6: 106,769,556 probably null Het
Vmn1r228 A T 17: 20,776,410 I282N probably damaging Het
Vps13d A T 4: 145,181,114 probably null Het
Zfp703 A G 8: 26,978,690 I51V unknown Het
Zfp787 A G 7: 6,132,191 F354L probably benign Het
Znrf2 T C 6: 54,817,347 V111A probably benign Het
Zwint G T 10: 72,657,092 R182L probably benign Het
Other mutations in Olfr1264
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1635:Olfr1264 UTSW 2 90021970 missense possibly damaging 0.94
R1758:Olfr1264 UTSW 2 90021329 missense probably benign
R1930:Olfr1264 UTSW 2 90021161 missense probably benign
R2159:Olfr1264 UTSW 2 90021538 missense probably damaging 0.97
R3977:Olfr1264 UTSW 2 90021745 missense probably damaging 1.00
R4028:Olfr1264 UTSW 2 90021223 missense probably damaging 1.00
R4884:Olfr1264 UTSW 2 90021643 missense probably benign 0.19
R5194:Olfr1264 UTSW 2 90021526 missense probably damaging 1.00
R5225:Olfr1264 UTSW 2 90021184 missense probably benign 0.00
R5399:Olfr1264 UTSW 2 90021923 missense probably benign 0.19
R5436:Olfr1264 UTSW 2 90021665 missense probably benign 0.25
R5753:Olfr1264 UTSW 2 90021503 missense possibly damaging 0.87
R6225:Olfr1264 UTSW 2 90021229 splice site probably null
R6391:Olfr1264 UTSW 2 90021631 missense probably benign 0.03
R6531:Olfr1264 UTSW 2 90021457 missense probably benign 0.03
R7293:Olfr1264 UTSW 2 90021527 missense probably damaging 1.00
R8014:Olfr1264 UTSW 2 90021743 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGCAATAAGTTTAGGCGCC -3'
(R):5'- AGTGCTCCGTGAAGCAAAG -3'

Sequencing Primer
(F):5'- CAATAAGTTTAGGCGCCAAAGAAG -3'
(R):5'- GCAAAGGGCATGTGATGATATTTAAG -3'
Posted On2019-12-20