Incidental Mutation 'R8046:Nnt'
ID618777
Institutional Source Beutler Lab
Gene Symbol Nnt
Ensembl Gene ENSMUSG00000025453
Gene Namenicotinamide nucleotide transhydrogenase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R8046 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location119335448-119408997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119374750 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 330 (M330K)
Ref Sequence ENSEMBL: ENSMUSP00000096753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069902] [ENSMUST00000099149] [ENSMUST00000109204] [ENSMUST00000223268]
Predicted Effect probably benign
Transcript: ENSMUST00000069902
SMART Domains Protein: ENSMUSP00000070564
Gene: ENSMUSG00000025453

DomainStartEndE-ValueType
AlaDh_PNT_N 60 199 3.35e-62 SMART
AlaDh_PNT_C 208 377 5.76e-43 SMART
transmembrane domain 409 431 N/A INTRINSIC
transmembrane domain 451 473 N/A INTRINSIC
transmembrane domain 486 508 N/A INTRINSIC
PDB:1U31|B 515 721 1e-145 PDB
SCOP:d1d4oa_ 542 718 1e-103 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099149
AA Change: M330K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096753
Gene: ENSMUSG00000025453
AA Change: M330K

DomainStartEndE-ValueType
AlaDh_PNT_N 60 199 3.35e-62 SMART
AlaDh_PNT_C 208 375 1.27e-39 SMART
transmembrane domain 395 412 N/A INTRINSIC
Blast:AlaDh_PNT_C 436 491 3e-28 BLAST
transmembrane domain 523 545 N/A INTRINSIC
transmembrane domain 565 587 N/A INTRINSIC
transmembrane domain 600 622 N/A INTRINSIC
PDB:1U31|B 629 835 1e-143 PDB
SCOP:d1d4oa_ 656 832 1e-102 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109204
AA Change: M330K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104827
Gene: ENSMUSG00000025453
AA Change: M330K

DomainStartEndE-ValueType
AlaDh_PNT_N 60 199 3.35e-62 SMART
AlaDh_PNT_C 208 375 1.27e-39 SMART
transmembrane domain 395 412 N/A INTRINSIC
Blast:AlaDh_PNT_C 436 491 2e-28 BLAST
transmembrane domain 523 545 N/A INTRINSIC
transmembrane domain 565 587 N/A INTRINSIC
transmembrane domain 600 622 N/A INTRINSIC
PDB:1U31|B 629 709 9e-46 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000223268
AA Change: M330K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mutations in this gene cause impaired glucose tolerance and loss of both glucose-dependent insulin secretion and ATP production in isolated pancreatic islets. Also, beta cells from ENU-induced mutants show enhanced glucose utilization and production of reactive oxygen species in response to glucose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G T 5: 76,896,478 D188E probably benign Het
Ahcyl2 T C 6: 29,878,620 L273P probably damaging Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Angpt1 T C 15: 42,496,356 T227A probably benign Het
Ankle1 C T 8: 71,408,021 T374M probably damaging Het
Arhgap18 T C 10: 26,887,857 V481A probably damaging Het
Astn2 A T 4: 66,266,350 L170* probably null Het
Bms1 T C 6: 118,408,144 T368A probably benign Het
Boll A G 1: 55,346,403 I121T probably damaging Het
Brca1 A C 11: 101,525,470 C613G probably benign Het
Cdk14 T A 5: 5,249,159 I65F possibly damaging Het
Chn1 T C 2: 73,618,019 D335G probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Col12a1 A G 9: 79,706,226 probably null Het
Crtac1 T C 19: 42,309,053 probably benign Het
Dhx40 A T 11: 86,784,940 C507* probably null Het
Dok2 A G 14: 70,778,042 D403G probably damaging Het
Eif2b5 A G 16: 20,506,404 T556A possibly damaging Het
Eml6 A T 11: 29,758,981 V1480E probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Glra1 A G 11: 55,536,399 S120P probably damaging Het
Gm2035 T C 12: 87,919,565 D98G probably benign Het
Habp4 T C 13: 64,174,842 S242P probably benign Het
Igkv12-46 A G 6: 69,764,586 I95T probably damaging Het
Itch G T 2: 155,210,502 G674V probably damaging Het
Itpr2 A G 6: 146,426,459 L92P probably damaging Het
Kcnk2 A G 1: 189,258,736 probably null Het
Krt75 T C 15: 101,572,764 T192A probably benign Het
Lrp1b T A 2: 41,269,187 K1694N Het
Lrrc14 A G 15: 76,714,531 K456E possibly damaging Het
Map1lc3a G T 2: 155,277,209 probably benign Het
Naip5 T A 13: 100,222,233 M832L probably benign Het
Nectin1 A G 9: 43,792,501 T263A probably benign Het
Nrap T C 19: 56,320,251 N1711D possibly damaging Het
Olfm1 A G 2: 28,229,123 N285D possibly damaging Het
Olfr145 A T 9: 37,897,389 probably benign Het
Olfr32 T A 2: 90,138,815 E108V probably damaging Het
Olfr613 T A 7: 103,552,377 S197R possibly damaging Het
Pag1 A G 3: 9,699,422 Y224H probably damaging Het
Pde8a T C 7: 81,308,839 C322R possibly damaging Het
Pde8a A T 7: 81,317,370 T420S probably benign Het
Per2 A C 1: 91,435,703 L365R possibly damaging Het
Pml A G 9: 58,246,973 probably null Het
Ppp1r1a T A 15: 103,537,878 M1L possibly damaging Het
Ppp3r2 G T 4: 49,681,913 C12* probably null Het
Rbm20 C A 19: 53,817,971 A494D probably benign Het
Rsg1 A C 4: 141,220,037 Q243P probably damaging Het
Scyl1 C T 19: 5,760,592 R531Q possibly damaging Het
Skp2 C A 15: 9,139,600 V38F probably damaging Het
Slc27a3 A G 3: 90,389,667 C42R probably damaging Het
Tekt5 A G 16: 10,395,413 F3L probably benign Het
Tmem200c A G 17: 68,840,518 K32R probably benign Het
Tmprss11f T A 5: 86,528,273 R350W probably damaging Het
Tph2 A T 10: 115,179,594 I121N possibly damaging Het
Trim37 A G 11: 87,146,968 D176G possibly damaging Het
Trpc4 A T 3: 54,194,914 I78F probably damaging Het
Ttn T C 2: 76,779,485 K17526E probably damaging Het
Tuba8 A C 6: 121,222,873 Y172S probably damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Urb2 A T 8: 124,028,032 R159S possibly damaging Het
Usp25 T A 16: 77,109,175 C840S probably damaging Het
Vmn1r36 T A 6: 66,715,980 K304* probably null Het
Vmn1r37 C A 6: 66,731,672 T94N probably damaging Het
Vmn2r7 T C 3: 64,707,058 N445S probably damaging Het
Wnk4 G A 11: 101,274,092 G749D probably benign Het
Wscd2 G A 5: 113,551,115 V61I probably benign Het
Zfp85 T A 13: 67,748,979 R325* probably null Het
Other mutations in Nnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nnt APN 13 119369997 missense probably damaging 1.00
IGL02021:Nnt APN 13 119336247 utr 3 prime probably benign
IGL02792:Nnt APN 13 119357646 missense probably damaging 1.00
IGL02804:Nnt APN 13 119381674 critical splice donor site probably null
IGL03082:Nnt APN 13 119396868 missense probably damaging 1.00
BB001:Nnt UTSW 13 119386645 missense probably damaging 1.00
BB011:Nnt UTSW 13 119386645 missense probably damaging 1.00
R0122:Nnt UTSW 13 119368597 missense probably damaging 1.00
R0294:Nnt UTSW 13 119336267 missense probably benign 0.08
R0294:Nnt UTSW 13 119338417 missense possibly damaging 0.79
R0530:Nnt UTSW 13 119394721 missense probably damaging 1.00
R0839:Nnt UTSW 13 119394656 missense possibly damaging 0.86
R1590:Nnt UTSW 13 119386661 missense possibly damaging 0.90
R1642:Nnt UTSW 13 119404550 critical splice donor site probably null
R3772:Nnt UTSW 13 119396952 missense probably damaging 0.99
R3835:Nnt UTSW 13 119372495 missense probably damaging 1.00
R3921:Nnt UTSW 13 119366494 missense probably damaging 1.00
R4106:Nnt UTSW 13 119396791 missense probably benign 0.15
R4496:Nnt UTSW 13 119381765 missense probably damaging 1.00
R4609:Nnt UTSW 13 119357536 missense possibly damaging 0.80
R4897:Nnt UTSW 13 119404571 nonsense probably null
R5081:Nnt UTSW 13 119366400 missense probably damaging 0.98
R5461:Nnt UTSW 13 119368595 missense possibly damaging 0.96
R5842:Nnt UTSW 13 119394747 missense probably damaging 0.97
R6053:Nnt UTSW 13 119357509 missense possibly damaging 0.90
R6137:Nnt UTSW 13 119336328 missense possibly damaging 0.95
R7134:Nnt UTSW 13 119394662 missense probably damaging 0.98
R7815:Nnt UTSW 13 119357575 missense possibly damaging 0.80
R7831:Nnt UTSW 13 119370094 missense possibly damaging 0.57
R7924:Nnt UTSW 13 119386645 missense probably damaging 1.00
R8152:Nnt UTSW 13 119374676 missense probably benign 0.23
R8356:Nnt UTSW 13 119339832 missense probably damaging 1.00
R8461:Nnt UTSW 13 119368502 missense unknown
R8839:Nnt UTSW 13 119357637 missense unknown
R8860:Nnt UTSW 13 119339871 missense
RF007:Nnt UTSW 13 119396857 missense probably damaging 1.00
Z1088:Nnt UTSW 13 119338446 missense probably damaging 1.00
Z1177:Nnt UTSW 13 119354741 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACCACTGGATTTGTGACGG -3'
(R):5'- ATCCACCTTAAGGGAACTGGC -3'

Sequencing Primer
(F):5'- ACGGAGTTGCGTATTCTTGATAG -3'
(R):5'- GAACTGGCTTTAATAATAGAGTGGC -3'
Posted On2020-01-23