Incidental Mutation 'R0696:St8sia5'
ID63467
Institutional Source Beutler Lab
Gene Symbol St8sia5
Ensembl Gene ENSMUSG00000025425
Gene NameST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
SynonymsSiat8e, ST8SiaV
MMRRC Submission 038880-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R0696 (G1)
Quality Score181
Status Not validated
Chromosome18
Chromosomal Location77185853-77255450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77254464 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 254 (N254S)
Ref Sequence ENSEMBL: ENSMUSP00000078566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075290] [ENSMUST00000079618]
Predicted Effect probably damaging
Transcript: ENSMUST00000075290
AA Change: N290S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074764
Gene: ENSMUSG00000025425
AA Change: N290S

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 152 407 6.4e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079618
AA Change: N254S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078566
Gene: ENSMUSG00000025425
AA Change: N254S

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 112 372 5.4e-79 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that may be present in the Golgi apparatus. The encoded protein, which is a member of glycosyltransferase family 29, may be involved in the synthesis of gangliosides GD1c, GT1a, GQ1b, and GT3 from GD1a, GT1b, GM1b, and GD3, respectively. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amigo2 T C 15: 97,245,974 K189R probably benign Het
Arpp21 A T 9: 112,183,589 probably null Het
Atp6v1a G T 16: 44,087,471 Q603K probably benign Het
Bcorl1 C A X: 48,406,018 P1722H probably damaging Het
Cd209a C A 8: 3,748,384 A55S possibly damaging Het
Cdh6 A G 15: 13,051,332 V405A probably benign Het
Cdsn A T 17: 35,555,996 Q474L possibly damaging Het
Col4a4 T A 1: 82,492,549 D753V unknown Het
Csmd3 T C 15: 47,847,173 T1569A probably benign Het
Cul7 C T 17: 46,659,608 P1084L probably damaging Het
Cyp7b1 T C 3: 18,072,585 T466A probably benign Het
Enpp2 C T 15: 54,897,696 W253* probably null Het
Igf2bp2 A T 16: 22,080,125 S245T probably benign Het
Lmnb1 A G 18: 56,740,721 T400A probably damaging Het
Mecom T C 3: 29,956,389 T724A probably benign Het
Mybl1 T C 1: 9,673,148 N560D probably damaging Het
Nav1 A G 1: 135,532,614 S324P probably damaging Het
Prrc2c C T 1: 162,708,852 probably null Het
Rgma T C 7: 73,409,412 V88A probably damaging Het
Slc7a1 A T 5: 148,340,556 V383E probably benign Het
Stx19 A G 16: 62,822,043 K74R probably benign Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Uap1 G A 1: 170,149,274 P452L probably benign Het
Zfp101 C T 17: 33,381,427 A452T possibly damaging Het
Zfp820 A G 17: 21,820,060 S96P possibly damaging Het
Other mutations in St8sia5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:St8sia5 APN 18 77254662 missense probably damaging 1.00
IGL01320:St8sia5 APN 18 77254622 missense probably damaging 1.00
IGL01682:St8sia5 APN 18 77248500 missense probably damaging 0.99
IGL01984:St8sia5 APN 18 77248461 missense probably benign 0.03
ANU22:St8sia5 UTSW 18 77254662 missense probably damaging 1.00
R0194:St8sia5 UTSW 18 77254724 missense probably benign 0.13
R0392:St8sia5 UTSW 18 77254406 missense probably damaging 1.00
R0622:St8sia5 UTSW 18 77246113 missense probably damaging 1.00
R1231:St8sia5 UTSW 18 77232806 missense probably damaging 0.97
R1559:St8sia5 UTSW 18 77211764 critical splice donor site probably null
R2058:St8sia5 UTSW 18 77254763 missense probably damaging 1.00
R2059:St8sia5 UTSW 18 77254763 missense probably damaging 1.00
R2268:St8sia5 UTSW 18 77232830 missense probably damaging 0.99
R4399:St8sia5 UTSW 18 77253018 missense probably damaging 1.00
R4926:St8sia5 UTSW 18 77254782 missense possibly damaging 0.84
R5986:St8sia5 UTSW 18 77254782 missense possibly damaging 0.84
R6301:St8sia5 UTSW 18 77246140 missense probably damaging 0.98
R7020:St8sia5 UTSW 18 77246180 missense probably damaging 0.97
R7087:St8sia5 UTSW 18 77254542 missense possibly damaging 0.88
R7784:St8sia5 UTSW 18 77254550 missense probably benign 0.36
R8037:St8sia5 UTSW 18 77248542 missense possibly damaging 0.95
R8153:St8sia5 UTSW 18 77253111 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTCTGAGAAATGCCACCTTCCTGG -3'
(R):5'- TCTCCGAGGGCATAGCATGGAAAC -3'

Sequencing Primer
(F):5'- gtgggaggagaaggggg -3'
(R):5'- TAGCATGGAAACCCGGCTTG -3'
Posted On2013-07-30