Incidental Mutation 'R8236:Tcam1'
ID637370
Institutional Source Beutler Lab
Gene Symbol Tcam1
Ensembl Gene ENSMUSG00000020712
Gene Nametesticular cell adhesion molecule 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8236 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106276672-106288745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106286417 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 412 (I412V)
Ref Sequence ENSEMBL: ENSMUSP00000044757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044462] [ENSMUST00000142472]
Predicted Effect probably benign
Transcript: ENSMUST00000044462
AA Change: I412V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000044757
Gene: ENSMUSG00000020712
AA Change: I412V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 112 5.4e-30 PFAM
IG_like 117 214 1.66e2 SMART
IG_like 316 397 5.04e1 SMART
IG 408 478 2.79e0 SMART
transmembrane domain 488 510 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142472
SMART Domains Protein: ENSMUSP00000115544
Gene: ENSMUSG00000020712

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 112 3.2e-30 PFAM
Pfam:Ig_2 109 214 1.7e-2 PFAM
Pfam:Ig_2 311 396 5.1e-3 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik C T 1: 86,046,393 A144V possibly damaging Het
Actr8 A G 14: 29,982,628 I51M probably damaging Het
Afm A T 5: 90,523,888 D143V probably damaging Het
Ankfy1 T A 11: 72,754,355 S753R possibly damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
Birc6 G C 17: 74,611,131 L1845F probably damaging Het
Brip1 C A 11: 86,139,112 D569Y probably damaging Het
Cab39 T C 1: 85,848,371 L263P probably damaging Het
Cblb C A 16: 52,166,029 P545Q possibly damaging Het
Ccdc64 T C 5: 115,649,559 H527R probably benign Het
Cdk5rap2 G T 4: 70,242,485 P1579Q probably benign Het
Cdt1 A G 8: 122,572,028 E468G probably damaging Het
Col28a1 A G 6: 8,097,024 probably null Het
Coro2a A G 4: 46,548,796 I166T possibly damaging Het
Ctnnd2 G A 15: 30,647,018 A287T probably benign Het
Dcc C T 18: 71,955,018 V50I probably benign Het
Defb30 A T 14: 63,049,767 M19K unknown Het
Dync2h1 C A 9: 7,080,363 probably benign Het
Edc4 A G 8: 105,892,273 T1291A possibly damaging Het
Epyc A T 10: 97,681,205 N302Y probably damaging Het
Espn G A 4: 152,149,030 T106I probably damaging Het
Fam135a T C 1: 24,020,648 probably null Het
Fam171b G A 2: 83,880,206 E741K probably damaging Het
Fgfr1 G T 8: 25,562,272 E205* probably null Het
Flt3 A G 5: 147,356,860 S469P probably benign Het
Gdpd3 A G 7: 126,768,666 K224E probably benign Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm43518 C T 5: 123,934,222 Q17* probably null Het
Gm4353 T C 7: 116,083,383 Y321C probably damaging Het
Gphn A G 12: 78,664,537 H631R probably damaging Het
Hook1 T A 4: 96,014,805 probably null Het
Il9 T A 13: 56,482,245 probably benign Het
Itpr2 A G 6: 146,390,783 probably null Het
Lhcgr A T 17: 88,742,586 L504* probably null Het
Mical3 A G 6: 121,012,543 V272A Het
Mup10 A G 4: 60,581,563 I63T probably damaging Het
Mxi1 C G 19: 53,369,598 P165R probably damaging Het
Nanog A T 6: 122,713,172 I179F probably benign Het
Olfr1137 T A 2: 87,711,760 I49F possibly damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pip A G 6: 41,847,662 D28G probably damaging Het
Ppp2r3d T C 9: 124,440,067 H53R Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Ptpn4 A G 1: 119,678,822 V781A possibly damaging Het
Ptprt C T 2: 161,687,068 probably null Het
Rtf1 T C 2: 119,701,214 S141P probably damaging Het
Slc2a1 G C 4: 119,133,257 S226T probably benign Het
Smyd3 A C 1: 179,405,640 probably null Het
Sos1 T C 17: 80,408,283 E1015G probably benign Het
Sult1b1 G T 5: 87,521,524 T155N probably damaging Het
Tet2 G A 3: 133,487,786 P296S probably benign Het
Tmem30c T C 16: 57,276,179 D193G probably null Het
Trem2 G T 17: 48,351,906 W233L probably benign Het
Trpm3 C A 19: 22,987,408 D1422E probably benign Het
Ttbk1 T G 17: 46,470,729 D366A probably damaging Het
Ttyh1 G A 7: 4,125,548 G148D probably benign Het
Ubr2 T C 17: 46,951,909 M1259V probably benign Het
Zfp608 T A 18: 54,899,209 D553V probably damaging Het
Zkscan2 A G 7: 123,479,912 S941P probably benign Het
Zranb1 T C 7: 132,949,664 Y15H probably damaging Het
Other mutations in Tcam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03189:Tcam1 APN 11 106285386 missense probably benign
IGL03396:Tcam1 APN 11 106285386 missense probably benign
IGL03397:Tcam1 APN 11 106285386 missense probably benign
R0241:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0241:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0306:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0313:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0378:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0380:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0381:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0382:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0393:Tcam1 UTSW 11 106284214 missense probably benign 0.19
R0401:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0448:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0537:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0602:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0669:Tcam1 UTSW 11 106285426 missense possibly damaging 0.94
R0706:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R2307:Tcam1 UTSW 11 106284114 missense probably damaging 1.00
R4957:Tcam1 UTSW 11 106282879 missense probably damaging 1.00
R5050:Tcam1 UTSW 11 106285452 missense possibly damaging 0.93
R5269:Tcam1 UTSW 11 106285527 missense probably benign 0.24
R5437:Tcam1 UTSW 11 106285423 missense probably damaging 1.00
R6235:Tcam1 UTSW 11 106284054 nonsense probably null
R6248:Tcam1 UTSW 11 106282826 missense probably benign 0.17
R6302:Tcam1 UTSW 11 106286450 missense probably damaging 1.00
R7399:Tcam1 UTSW 11 106284085 missense probably damaging 1.00
R8402:Tcam1 UTSW 11 106286905 missense probably damaging 0.99
Z1177:Tcam1 UTSW 11 106282847 frame shift probably null
Z1177:Tcam1 UTSW 11 106282850 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GCTGCATCCCATATCCTGTG -3'
(R):5'- CAATGATAGTGATGTCTTTGCTGAC -3'

Sequencing Primer
(F):5'- ATCCCATATCCTGTGCGGTGG -3'
(R):5'- TGACGGAGCCTAGTGGG -3'
Posted On2020-07-13