Incidental Mutation 'R0313:Tcam1'
ID25349
Institutional Source Beutler Lab
Gene Symbol Tcam1
Ensembl Gene ENSMUSG00000020712
Gene Nametesticular cell adhesion molecule 1
Synonyms
MMRRC Submission 038523-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0313 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106276672-106288745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106284078 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 120 (E120K)
Ref Sequence ENSEMBL: ENSMUSP00000044757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044462] [ENSMUST00000142472]
Predicted Effect probably benign
Transcript: ENSMUST00000044462
AA Change: E120K

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044757
Gene: ENSMUSG00000020712
AA Change: E120K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 112 5.4e-30 PFAM
IG_like 117 214 1.66e2 SMART
IG_like 316 397 5.04e1 SMART
IG 408 478 2.79e0 SMART
transmembrane domain 488 510 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142472
AA Change: E120K

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115544
Gene: ENSMUSG00000020712
AA Change: E120K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 112 3.2e-30 PFAM
Pfam:Ig_2 109 214 1.7e-2 PFAM
Pfam:Ig_2 311 396 5.1e-3 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.9%
  • 20x: 88.5%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 A G 6: 58,672,097 E309G probably benign Het
AI314180 A G 4: 58,811,892 I1411T probably benign Het
Ankmy1 C T 1: 92,886,221 G412D probably damaging Het
Cc2d1a G A 8: 84,136,969 T542I probably benign Het
Cldn18 T C 9: 99,698,914 I94V probably benign Het
Cobll1 G A 2: 65,095,744 R1195* probably null Het
Dnah7b A G 1: 46,207,643 T1660A probably damaging Het
Dzip3 G T 16: 48,937,061 Q870K probably damaging Het
Ebf4 T C 2: 130,306,787 probably benign Het
Esyt2 T C 12: 116,347,808 L439P probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Haspin A G 11: 73,136,298 V655A probably damaging Het
Kmt2c T C 5: 25,344,930 E1351G probably damaging Het
Lama2 C A 10: 26,993,398 probably null Het
Lcp1 A G 14: 75,199,433 E73G probably damaging Het
Ltv1 C T 10: 13,182,860 probably null Het
Mcmdc2 A G 1: 9,932,141 Y529C probably damaging Het
Myo3b T A 2: 70,348,959 Y1172* probably null Het
Ncf1 T C 5: 134,229,567 M1V probably null Het
Olfr1297 C T 2: 111,621,600 S158N possibly damaging Het
Olfr250 T C 9: 38,368,304 S243P probably damaging Het
Olfr765 A G 10: 129,046,826 V79A possibly damaging Het
Pcif1 A T 2: 164,884,419 H80L probably damaging Het
Pclo T C 5: 14,678,873 probably benign Het
Polr2a T C 11: 69,735,080 Y1710C unknown Het
Ppp1r37 G A 7: 19,533,998 T324I probably damaging Het
Prmt1 T C 7: 44,978,748 D176G probably benign Het
Scn5a T C 9: 119,534,571 D501G probably damaging Het
Ska2 A G 11: 87,117,814 I89M possibly damaging Het
Slc39a7 G A 17: 34,029,544 A375V probably damaging Het
Ssrp1 T A 2: 85,041,554 I374N probably damaging Het
Stox2 C T 8: 47,192,134 G828R probably damaging Het
Uqcrc1 C A 9: 108,948,574 R114S possibly damaging Het
Usp38 A T 8: 80,984,442 L988* probably null Het
Vmn2r5 T A 3: 64,503,827 H440L probably benign Het
Wdr12 A T 1: 60,082,579 I271N possibly damaging Het
Xylt2 C T 11: 94,669,894 probably benign Het
Other mutations in Tcam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03189:Tcam1 APN 11 106285386 missense probably benign
IGL03396:Tcam1 APN 11 106285386 missense probably benign
IGL03397:Tcam1 APN 11 106285386 missense probably benign
R0241:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0241:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0306:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0378:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0380:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0381:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0382:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0393:Tcam1 UTSW 11 106284214 missense probably benign 0.19
R0401:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0448:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0537:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0602:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0669:Tcam1 UTSW 11 106285426 missense possibly damaging 0.94
R0706:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R2307:Tcam1 UTSW 11 106284114 missense probably damaging 1.00
R4957:Tcam1 UTSW 11 106282879 missense probably damaging 1.00
R5050:Tcam1 UTSW 11 106285452 missense possibly damaging 0.93
R5269:Tcam1 UTSW 11 106285527 missense probably benign 0.24
R5437:Tcam1 UTSW 11 106285423 missense probably damaging 1.00
R6235:Tcam1 UTSW 11 106284054 nonsense probably null
R6248:Tcam1 UTSW 11 106282826 missense probably benign 0.17
R6302:Tcam1 UTSW 11 106286450 missense probably damaging 1.00
R7399:Tcam1 UTSW 11 106284085 missense probably damaging 1.00
R8236:Tcam1 UTSW 11 106286417 missense probably benign 0.01
R8402:Tcam1 UTSW 11 106286905 missense probably damaging 0.99
Z1177:Tcam1 UTSW 11 106282847 frame shift probably null
Z1177:Tcam1 UTSW 11 106282850 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- CCAAGCTTCTTATGCCTCTGAGACC -3'
(R):5'- AGAAATTACGCCTGTCATTGTCCCG -3'

Sequencing Primer
(F):5'- GCCTCTGAGACCTCTCTGATAAG -3'
(R):5'- CGGTGGGCTCTGACAGTG -3'
Posted On2013-04-16