Incidental Mutation 'R8238:Glipr1'
ID637471
Institutional Source Beutler Lab
Gene Symbol Glipr1
Ensembl Gene ENSMUSG00000056888
Gene NameGLI pathogenesis-related 1 (glioma)
SynonymsRTVP1, RTVP-1, 2410114O14Rik, mRTVP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R8238 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location111985448-112002631 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 111993440 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000074359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074805] [ENSMUST00000161870] [ENSMUST00000162508]
Predicted Effect probably null
Transcript: ENSMUST00000074805
SMART Domains Protein: ENSMUSP00000074359
Gene: ENSMUSG00000056888

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SCP 32 172 4.04e-55 SMART
transmembrane domain 222 244 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161870
SMART Domains Protein: ENSMUSP00000134094
Gene: ENSMUSG00000056888

DomainStartEndE-ValueType
Pfam:CAP 1 42 9.2e-10 PFAM
low complexity region 82 93 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162508
SMART Domains Protein: ENSMUSP00000123990
Gene: ENSMUSG00000056888

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SCP 32 172 4.04e-55 SMART
transmembrane domain 222 244 N/A INTRINSIC
Meta Mutation Damage Score 0.9506 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to both the pathogenesis-related protein (PR) superfamily and the cysteine-rich secretory protein (CRISP) family. Increased expression of this gene is associated with myelomocytic differentiation in macrophage and decreased expression of this gene through gene methylation is associated with prostate cancer. The protein has proapoptotic activities in prostate and bladder cancer cells. This gene is a member of a cluster on chromosome 12 containing two other similar genes. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene renders mice more vulnerable to spontaneous tumorigenesis, leading to the formation of a wide spectrum of tumors and significantly shorter tumor-free survival times. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 A G 8: 43,650,956 Y551H probably damaging Het
Ak1 T A 2: 32,633,669 V198D probably damaging Het
Alx1 C T 10: 103,022,215 D208N possibly damaging Het
Atp5b T A 10: 128,085,150 I182N possibly damaging Het
Cabp5 T A 7: 13,405,452 M134K probably damaging Het
Camsap2 A T 1: 136,294,026 I227N probably benign Het
Cfap44 G A 16: 44,415,305 probably null Het
Dpyd G A 3: 119,195,193 probably null Het
Etl4 C T 2: 20,806,531 R1510* probably null Het
Fgr C T 4: 132,997,521 A311V probably damaging Het
Gm10799 A G 2: 104,068,151 F70L probably benign Het
Gm14412 A T 2: 177,315,318 H261Q unknown Het
Hey2 T A 10: 30,840,663 M35L probably benign Het
Hspb7 A G 4: 141,422,546 Y81C probably damaging Het
Ipo5 A T 14: 120,935,240 K570M probably damaging Het
Iqsec1 A T 6: 90,689,930 H404Q probably benign Het
Kif5b T A 18: 6,227,619 Q86L probably damaging Het
Lrrtm4 T A 6: 80,022,685 I360N probably damaging Het
Mup6 T A 4: 60,003,634 V29E probably damaging Het
Ncstn G T 1: 172,072,476 A277E probably damaging Het
Nsun3 A G 16: 62,770,713 V189A probably damaging Het
Oaf C T 9: 43,239,345 D77N probably damaging Het
Olfr545 T C 7: 102,494,620 T52A possibly damaging Het
Olfr60 A C 7: 140,345,890 L33W probably damaging Het
Pard6a A G 8: 105,702,734 D138G probably damaging Het
Ppp4r4 A C 12: 103,590,807 H434P probably benign Het
Sec23b T C 2: 144,564,648 I121T probably benign Het
Slc36a3 C T 11: 55,131,607 V254I probably benign Het
Slc7a14 C A 3: 31,227,151 V337L probably benign Het
Svs1 A G 6: 48,990,041 E641G probably damaging Het
Tdh C T 14: 63,495,724 G206E probably damaging Het
Vmn1r231 T C 17: 20,890,378 T92A probably benign Het
Vmn2r36 T G 7: 7,889,016 H431P probably benign Het
Vmn2r92 G T 17: 18,185,016 M807I probably benign Het
Vps11 T C 9: 44,352,760 T759A probably benign Het
Xdh G T 17: 73,886,417 Q1295K probably benign Het
Other mutations in Glipr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Glipr1 APN 10 111985650 missense probably benign
IGL00553:Glipr1 APN 10 111986669 missense possibly damaging 0.79
IGL02391:Glipr1 APN 10 111988894 unclassified probably benign
R0115:Glipr1 UTSW 10 111993541 missense probably benign 0.00
R0486:Glipr1 UTSW 10 111996849 splice site probably benign
R1349:Glipr1 UTSW 10 111993532 missense probably benign 0.02
R1822:Glipr1 UTSW 10 111996860 missense possibly damaging 0.84
R4364:Glipr1 UTSW 10 111985637 missense possibly damaging 0.84
R4905:Glipr1 UTSW 10 111985640 missense probably damaging 1.00
R4974:Glipr1 UTSW 10 111993506 nonsense probably null
R5734:Glipr1 UTSW 10 111985793 nonsense probably null
R7603:Glipr1 UTSW 10 111988832 missense probably benign 0.07
Z1176:Glipr1 UTSW 10 111988837 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CATGCCAGTGTCTTGTACTGTC -3'
(R):5'- GCCCAAATTGCAAAAGCATGG -3'

Sequencing Primer
(F):5'- GTACTGTCTAGATGGATGGCC -3'
(R):5'- TGCAAAAGCATGGACAAAATCTTGTG -3'
Posted On2020-07-13