Incidental Mutation 'R0708:Ints14'
ID63860
Institutional Source Beutler Lab
Gene Symbol Ints14
Ensembl Gene ENSMUSG00000034263
Gene Nameintegrator complex subunit 14
SynonymsVwa9, 2010321M09Rik
MMRRC Submission 038891-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.767) question?
Stock #R0708 (G1)
Quality Score156
Status Not validated
Chromosome9
Chromosomal Location64960905-64986978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 64983984 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 416 (V416I)
Ref Sequence ENSEMBL: ENSMUSP00000127420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036615] [ENSMUST00000037504] [ENSMUST00000170517]
Predicted Effect probably benign
Transcript: ENSMUST00000036615
SMART Domains Protein: ENSMUSP00000044955
Gene: ENSMUSG00000033629

DomainStartEndE-ValueType
Pfam:CS 8 84 2.3e-7 PFAM
low complexity region 119 136 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
Pfam:PTPLA 195 356 1.5e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037504
AA Change: V416I

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000049284
Gene: ENSMUSG00000034263
AA Change: V416I

DomainStartEndE-ValueType
VWA 2 181 7.54e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170517
AA Change: V416I

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127420
Gene: ENSMUSG00000034263
AA Change: V416I

DomainStartEndE-ValueType
VWA 2 181 7.54e0 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brdt A T 5: 107,358,900 K450* probably null Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Col9a1 A T 1: 24,237,261 Q750L possibly damaging Het
Dnah6 A T 6: 73,212,622 S14R probably benign Het
Enox1 A G 14: 77,592,912 N319S probably benign Het
Frs2 G A 10: 117,074,092 T455M probably damaging Het
Glra3 C T 8: 56,125,364 probably benign Het
Gmppa T C 1: 75,442,574 F375S probably damaging Het
Hectd4 G A 5: 121,286,463 probably null Het
Hgf C A 5: 16,566,763 C129* probably null Het
Insc T A 7: 114,845,146 V456E probably damaging Het
Klk1b11 T C 7: 43,997,728 F29L possibly damaging Het
Ogfod1 C T 8: 94,039,045 L79F possibly damaging Het
Olfr926 T A 9: 38,877,275 V33E probably damaging Het
Orc3 A T 4: 34,597,368 I224N probably damaging Het
Papss2 T C 19: 32,637,216 F111L probably damaging Het
Poc1b A G 10: 99,155,130 D291G probably null Het
Prl8a8 A T 13: 27,511,545 M72K possibly damaging Het
Ptpn7 C A 1: 135,134,547 T77K probably damaging Het
Ptpro T C 6: 137,386,253 S462P probably benign Het
Rab3gap2 T A 1: 185,249,926 S392T probably damaging Het
Sema4d A G 13: 51,712,719 V245A probably benign Het
Sgcb A T 5: 73,640,882 probably null Het
Slc24a1 T A 9: 64,947,890 K578N unknown Het
Sptbn1 A T 11: 30,114,739 V1920E probably damaging Het
Tecr A T 8: 83,573,109 I101N probably damaging Het
Tectb T C 19: 55,191,552 F277L probably benign Het
Tgs1 T A 4: 3,586,152 L343H probably benign Het
Thbs4 C A 13: 92,773,186 G368W probably damaging Het
Zfp558 T C 9: 18,456,827 S222G possibly damaging Het
Other mutations in Ints14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Ints14 APN 9 64972792 missense probably benign 0.30
R0376:Ints14 UTSW 9 64983990 missense probably damaging 0.98
R0589:Ints14 UTSW 9 64979831 missense probably damaging 1.00
R0614:Ints14 UTSW 9 64964433 missense probably benign
R1192:Ints14 UTSW 9 64966763 missense possibly damaging 0.86
R2114:Ints14 UTSW 9 64979795 missense probably damaging 1.00
R2115:Ints14 UTSW 9 64979795 missense probably damaging 1.00
R2117:Ints14 UTSW 9 64979795 missense probably damaging 1.00
R2484:Ints14 UTSW 9 64986084 missense probably benign
R4811:Ints14 UTSW 9 64964518 missense probably damaging 1.00
R4953:Ints14 UTSW 9 64982058 missense probably damaging 1.00
R5067:Ints14 UTSW 9 64964412 missense probably damaging 1.00
R6080:Ints14 UTSW 9 64966762 missense probably benign 0.02
R6326:Ints14 UTSW 9 64964437 missense probably benign 0.08
R6395:Ints14 UTSW 9 64978124 splice site probably null
R7036:Ints14 UTSW 9 64964545 missense probably benign
R7147:Ints14 UTSW 9 64983985 missense possibly damaging 0.93
R7203:Ints14 UTSW 9 64964419 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCACCAAACCTGGCTGTTACTG -3'
(R):5'- GCCACCCCTGATTGCACTGTTAAG -3'

Sequencing Primer
(F):5'- ggtccaacttcatttttctgtattc -3'
(R):5'- CCCTGATTGCACTGTTAAGAAAAC -3'
Posted On2013-07-30