Incidental Mutation 'R0614:Ints14'
Institutional Source Beutler Lab
Gene Symbol Ints14
Ensembl Gene ENSMUSG00000034263
Gene Nameintegrator complex subunit 14
SynonymsVwa9, 2010321M09Rik
MMRRC Submission 038803-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.569) question?
Stock #R0614 (G1)
Quality Score225
Status Validated
Chromosomal Location64960905-64986978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64964433 bp
Amino Acid Change Serine to Proline at position 18 (S18P)
Ref Sequence ENSEMBL: ENSMUSP00000127420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037504] [ENSMUST00000170517]
Predicted Effect probably benign
Transcript: ENSMUST00000037504
AA Change: S18P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049284
Gene: ENSMUSG00000034263
AA Change: S18P

VWA 2 181 7.54e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170517
AA Change: S18P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127420
Gene: ENSMUSG00000034263
AA Change: S18P

VWA 2 181 7.54e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215789
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,192,663 T137I probably benign Het
3110082I17Rik C T 5: 139,364,031 V88I possibly damaging Het
4930453N24Rik T A 16: 64,766,614 Q249L probably damaging Het
Akap2 C A 4: 57,856,720 A926E probably benign Het
Ap1g2 C T 14: 55,099,773 V702I probably benign Het
Armcx5 G A X: 135,746,815 E547K probably damaging Het
Asah2 C A 19: 32,016,728 V406L probably damaging Het
Atp8b1 T C 18: 64,533,587 probably benign Het
Axl C A 7: 25,774,163 R346L probably benign Het
Baz1a G A 12: 54,941,519 R282* probably null Het
Card14 A G 11: 119,322,827 N200S probably benign Het
Cdt1 A G 8: 122,568,137 T28A probably benign Het
Cep250 C T 2: 155,970,097 Q438* probably null Het
Dapk1 C A 13: 60,718,132 P181Q probably damaging Het
Dnah17 C T 11: 118,070,568 probably benign Het
Dph7 T C 2: 24,968,956 probably null Het
Edc4 A T 8: 105,889,396 D801V possibly damaging Het
Eif4g2 A G 7: 111,077,223 probably null Het
Eml2 T C 7: 19,202,591 L531P probably damaging Het
Ephb2 T C 4: 136,673,365 Y533C probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fsip2 A G 2: 82,977,533 K1399E probably benign Het
Hcls1 A G 16: 36,962,625 D446G probably damaging Het
Hif1a T A 12: 73,945,631 N787K probably damaging Het
Kalrn A T 16: 33,993,670 probably benign Het
Llgl2 T A 11: 115,850,267 D502E probably damaging Het
Lrwd1 A G 5: 136,123,500 V570A probably damaging Het
Mga C G 2: 119,964,466 P2877R probably damaging Het
Mvd T C 8: 122,436,553 I313V probably benign Het
Myo15b C A 11: 115,882,913 P270T probably damaging Het
Naip1 C A 13: 100,444,200 V180L probably benign Het
Ofd1 T C X: 166,435,540 probably benign Het
Olfr1233 T A 2: 89,339,985 I106F probably damaging Het
Olfr1423 A T 19: 12,036,565 M59K possibly damaging Het
Olfr348 T A 2: 36,786,693 L56H probably damaging Het
Otogl G A 10: 107,798,355 P1420S probably benign Het
Pcnt C T 10: 76,420,316 V697M probably damaging Het
Plekha7 A T 7: 116,154,645 Y702* probably null Het
Plxnb3 A G X: 73,764,358 probably benign Het
Ptgis A G 2: 167,206,882 F405L probably damaging Het
Ptprk C T 10: 28,075,136 P19L probably damaging Het
Ptprt A G 2: 161,812,120 V530A possibly damaging Het
Rasgrp4 A T 7: 29,145,851 Y299F probably damaging Het
Slc39a11 T A 11: 113,523,626 probably null Het
Slc6a15 T A 10: 103,404,352 L312* probably null Het
Slf1 T A 13: 77,049,114 M794L probably benign Het
Sntg2 G A 12: 30,257,978 T236I possibly damaging Het
Stau1 T C 2: 166,950,806 Y413C probably damaging Het
Syne2 T G 12: 75,912,353 probably null Het
Tas2r104 A T 6: 131,685,202 N181K probably damaging Het
Tmem81 G A 1: 132,507,731 V92I probably benign Het
Trap1 A G 16: 4,060,751 probably benign Het
Trip12 T C 1: 84,757,761 E905G probably damaging Het
Usp2 C T 9: 44,092,492 R494* probably null Het
Vps13a G T 19: 16,652,694 R2692S probably damaging Het
Zfhx3 T C 8: 108,948,539 S2074P probably benign Het
Zfhx3 C G 8: 108,948,967 Y2216* probably null Het
Zfp423 A G 8: 87,782,114 F409S probably damaging Het
Zfp472 G A 17: 32,977,934 E328K possibly damaging Het
Zfp619 T A 7: 39,537,675 M1043K possibly damaging Het
Zfp940 T C 7: 29,846,246 I79V probably benign Het
Other mutations in Ints14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Ints14 APN 9 64972792 missense probably benign 0.30
R0376:Ints14 UTSW 9 64983990 missense probably damaging 0.98
R0589:Ints14 UTSW 9 64979831 missense probably damaging 1.00
R0708:Ints14 UTSW 9 64983984 missense probably benign 0.29
R1192:Ints14 UTSW 9 64966763 missense possibly damaging 0.86
R2114:Ints14 UTSW 9 64979795 missense probably damaging 1.00
R2115:Ints14 UTSW 9 64979795 missense probably damaging 1.00
R2117:Ints14 UTSW 9 64979795 missense probably damaging 1.00
R2484:Ints14 UTSW 9 64986084 missense probably benign
R4811:Ints14 UTSW 9 64964518 missense probably damaging 1.00
R4953:Ints14 UTSW 9 64982058 missense probably damaging 1.00
R5067:Ints14 UTSW 9 64964412 missense probably damaging 1.00
R6080:Ints14 UTSW 9 64966762 missense probably benign 0.02
R6326:Ints14 UTSW 9 64964437 missense probably benign 0.08
R6395:Ints14 UTSW 9 64978124 splice site probably null
R7036:Ints14 UTSW 9 64964545 missense probably benign
R7147:Ints14 UTSW 9 64983985 missense possibly damaging 0.93
R7203:Ints14 UTSW 9 64964419 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gttcaaatcccagcaaccac -3'
Posted On2013-07-11