Incidental Mutation 'R0094:Dtx1'
ID 64000
Institutional Source Beutler Lab
Gene Symbol Dtx1
Ensembl Gene ENSMUSG00000029603
Gene Name deltex 1, E3 ubiquitin ligase
Synonyms Fxit1
MMRRC Submission 038380-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0094 (G1)
Quality Score 100
Status Not validated
Chromosome 5
Chromosomal Location 120680202-120711927 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120682624 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 455 (Y455H)
Ref Sequence ENSEMBL: ENSMUSP00000031607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031606] [ENSMUST00000031607] [ENSMUST00000156722]
AlphaFold Q61010
Predicted Effect probably benign
Transcript: ENSMUST00000031606
SMART Domains Protein: ENSMUSP00000031606
Gene: ENSMUSG00000029602

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000031607
AA Change: Y455H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031607
Gene: ENSMUSG00000029603
AA Change: Y455H

DomainStartEndE-ValueType
WWE 23 102 1.29e-38 SMART
WWE 104 179 3.88e-33 SMART
low complexity region 226 251 N/A INTRINSIC
low complexity region 258 290 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
RING 418 478 5.82e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154759
Predicted Effect probably benign
Transcript: ENSMUST00000156722
SMART Domains Protein: ENSMUSP00000123266
Gene: ENSMUSG00000029602

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201264
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Studies in Drosophila have identified this gene as encoding a positive regulator of the Notch-signaling pathway. The human gene encodes a protein of unknown function; however, it may play a role in basic helix-loop-helix transcription factor activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile with normal B and T cell devlepment and function and no gross abnormalities in any of the major organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik T A 9: 46,306,886 T185S possibly damaging Het
Amotl1 A G 9: 14,575,387 S441P probably benign Het
Ap5z1 G A 5: 142,476,812 V626M probably benign Het
Cacna2d3 C T 14: 29,170,503 probably null Het
Cfap77 A T 2: 28,984,434 V128D probably damaging Het
Colgalt1 T C 8: 71,623,158 V483A probably damaging Het
Dcdc2b T C 4: 129,610,311 probably null Het
Dsg2 A T 18: 20,591,853 T439S probably benign Het
Frmpd1 C A 4: 45,284,899 S1240* probably null Het
Gypa T A 8: 80,500,931 H69Q unknown Het
Mfap5 G A 6: 122,525,992 V54I probably damaging Het
Mroh7 C T 4: 106,703,184 G641E probably damaging Het
Mvd C T 8: 122,439,703 R65H probably benign Het
Olfr293 A G 7: 86,664,294 S211G probably benign Het
Pigs T A 11: 78,340,038 N370K probably damaging Het
Pkd1 A G 17: 24,581,276 T3004A possibly damaging Het
Pkhd1 T A 1: 20,209,246 R2949S probably damaging Het
Ptpro T C 6: 137,386,352 Y495H probably benign Het
Rfc4 G T 16: 23,115,428 Q208K probably benign Het
Rpa2 T C 4: 132,770,582 S52P probably damaging Het
Sirpb1c G T 3: 15,838,758 T94K possibly damaging Het
Sis A T 3: 72,921,437 N1136K probably damaging Het
Spp2 T A 1: 88,420,680 probably null Het
Ubr3 C T 2: 69,951,362 T628I probably damaging Het
Vmn1r213 A G 13: 23,011,649 H134R probably damaging Het
Vmn2r59 T C 7: 42,012,298 R698G probably benign Het
Other mutations in Dtx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02733:Dtx1 APN 5 120681435 missense probably damaging 1.00
IGL03104:Dtx1 APN 5 120694965 missense possibly damaging 0.77
IGL03139:Dtx1 APN 5 120694890 missense probably damaging 0.96
R0173:Dtx1 UTSW 5 120682753 unclassified probably benign
R0268:Dtx1 UTSW 5 120681291 missense probably damaging 1.00
R0375:Dtx1 UTSW 5 120681399 missense probably damaging 1.00
R0452:Dtx1 UTSW 5 120694992 missense possibly damaging 0.94
R1109:Dtx1 UTSW 5 120710419 start gained probably benign
R1456:Dtx1 UTSW 5 120710504 utr 5 prime probably benign
R1541:Dtx1 UTSW 5 120710346 start gained probably benign
R1554:Dtx1 UTSW 5 120683321 missense probably damaging 1.00
R2042:Dtx1 UTSW 5 120694476 missense probably benign 0.24
R2568:Dtx1 UTSW 5 120710184 missense possibly damaging 0.84
R3946:Dtx1 UTSW 5 120681286 missense possibly damaging 0.53
R4697:Dtx1 UTSW 5 120694408 critical splice donor site probably null
R6150:Dtx1 UTSW 5 120681363 missense probably damaging 1.00
R6564:Dtx1 UTSW 5 120695017 missense probably benign 0.13
R6980:Dtx1 UTSW 5 120681357 missense probably damaging 1.00
R7000:Dtx1 UTSW 5 120695083 missense probably damaging 0.98
R7399:Dtx1 UTSW 5 120682393 missense possibly damaging 0.60
R9117:Dtx1 UTSW 5 120710291 missense probably benign
Z1176:Dtx1 UTSW 5 120683295 missense probably benign
Z1177:Dtx1 UTSW 5 120681351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAACTCCATCTTCCCTGGTGGC -3'
(R):5'- AGTTTAACAGCATCGCACCTGTCC -3'

Sequencing Primer
(F):5'- GCTTTGCAGGTTGGACAC -3'
(R):5'- GGGTGATTAAGCATTTAACCCCTG -3'
Posted On 2013-08-06