Incidental Mutation 'R8312:Lce1l'
ID641422
Institutional Source Beutler Lab
Gene Symbol Lce1l
Ensembl Gene ENSMUSG00000046676
Gene Namelate cornified envelope 1L
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R8312 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location92849949-92851286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 92850459 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 31 (P31A)
Ref Sequence ENSEMBL: ENSMUSP00000057762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054426]
Predicted Effect unknown
Transcript: ENSMUST00000054426
AA Change: P31A
SMART Domains Protein: ENSMUSP00000057762
Gene: ENSMUSG00000046676
AA Change: P31A

DomainStartEndE-ValueType
Pfam:LCE 25 67 1.6e-12 PFAM
Pfam:LCE 65 135 2.5e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T C 12: 84,615,416 R23G probably damaging Het
Acnat1 A T 4: 49,449,142 L208* probably null Het
Agbl5 A G 5: 30,894,506 E556G probably damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Arih2 A G 9: 108,644,274 S2P probably damaging Het
C87436 T A 6: 86,457,831 L387Q probably damaging Het
Card9 A T 2: 26,357,789 Y183* probably null Het
Cdk14 T C 5: 4,894,141 D394G probably benign Het
Cep135 C T 5: 76,636,899 S947L probably damaging Het
Cfb T C 17: 34,858,145 K505E probably benign Het
Cnot4 T A 6: 35,023,141 D708V probably damaging Het
Col16a1 T A 4: 130,054,451 L281M unknown Het
Col6a3 G T 1: 90,813,690 D673E possibly damaging Het
Ctdnep1 G A 11: 69,988,701 S150N probably benign Het
Fam175b A G 7: 132,876,600 Y163C probably damaging Het
Fras1 T A 5: 96,588,191 N548K probably benign Het
Gbp2b A G 3: 142,599,051 M83V probably benign Het
Gbp2b C A 3: 142,599,054 P84T probably damaging Het
Grn A C 11: 102,436,247 K557T probably damaging Het
Hapln1 C T 13: 89,601,444 A36V probably benign Het
Heg1 C T 16: 33,726,675 R635W probably benign Het
Hivep1 C A 13: 42,155,177 Q298K possibly damaging Het
Hmcn1 A G 1: 150,738,764 I1297T probably damaging Het
Htr4 C G 18: 62,437,478 F201L probably damaging Het
Insrr C G 3: 87,800,484 Q78E possibly damaging Het
Itga6 A T 2: 71,855,953 M1072L probably benign Het
Kdsr A G 1: 106,747,486 probably null Het
Klhl7 T C 5: 24,134,967 I149T probably damaging Het
Mag T C 7: 30,911,469 Y116C probably damaging Het
Mast2 A G 4: 116,430,486 S131P probably benign Het
Mlec C A 5: 115,150,207 probably null Het
Mrap2 G A 9: 87,169,659 probably null Het
Myo5b A G 18: 74,733,962 K1395E probably damaging Het
Nipa2 G A 7: 55,933,302 Q232* probably null Het
Oit3 T C 10: 59,438,810 N56S probably benign Het
Olfr155 A T 4: 43,854,461 I51F probably benign Het
Olfr165 T C 16: 19,407,237 M260V probably benign Het
Olfr9 A G 10: 128,990,478 T189A probably benign Het
Pax3 C T 1: 78,195,369 R68Q probably damaging Het
Pcnx2 G T 8: 125,762,850 H1668Q possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pkd1 A G 17: 24,567,128 S463G probably benign Het
Plb1 C T 5: 32,328,485 T871M probably damaging Het
Prdx1 A G 4: 116,699,201 D182G possibly damaging Het
Prkch T A 12: 73,760,584 F593I noncoding transcript Het
Psrc1 C T 3: 108,386,357 P194L probably benign Het
Ptp4a2 A T 4: 129,839,634 I18L probably benign Het
Samd10 A T 2: 181,596,875 L153H probably damaging Het
Shc3 T G 13: 51,442,718 H423P probably damaging Het
Siae A T 9: 37,646,297 I467F Het
Slc27a5 C T 7: 12,991,287 R411Q probably damaging Het
Spata24 A G 18: 35,660,808 I56T probably benign Het
Spns3 G A 11: 72,499,708 T407M probably damaging Het
Spta1 G A 1: 174,240,211 C2068Y probably damaging Het
Svs2 C A 2: 164,238,171 G25W probably damaging Het
Thsd7a T C 6: 12,471,182 D479G Het
Trhde T C 10: 114,413,287 Y858C probably damaging Het
Ttn G A 2: 76,951,648 R1057C unknown Het
Tulp4 G T 17: 6,207,058 probably null Het
Tyk2 T C 9: 21,115,649 T613A possibly damaging Het
Ugt2b37 T C 5: 87,242,940 K356R probably benign Het
Vmn1r39 A G 6: 66,804,857 V159A noncoding transcript Het
Vps35 A G 8: 85,274,869 V440A possibly damaging Het
Whsc1l1 C T 8: 25,663,252 T536M probably damaging Het
Zmym6 A G 4: 127,123,834 N1136S probably damaging Het
Other mutations in Lce1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03202:Lce1l APN 3 92850324 missense unknown
R1724:Lce1l UTSW 3 92850419 missense unknown
R4075:Lce1l UTSW 3 92850233 missense unknown
R4515:Lce1l UTSW 3 92850474 missense unknown
R5531:Lce1l UTSW 3 92850497 missense unknown
R6785:Lce1l UTSW 3 92850193 nonsense probably null
R7298:Lce1l UTSW 3 92850176 missense unknown
R8310:Lce1l UTSW 3 92850459 missense unknown
Predicted Primers PCR Primer
(F):5'- TCGATGGCGACGAAGAGATC -3'
(R):5'- GTTTGTCTTGGAATCAGTGTCTAAC -3'

Sequencing Primer
(F):5'- CGAAGAGATCTGTGAGGCCTGTG -3'
(R):5'- CAGAATTGAGGATGGATATGTCTGC -3'
Posted On2020-07-28