Incidental Mutation 'R8312:Prkch'
ID641464
Institutional Source Beutler Lab
Gene Symbol Prkch
Ensembl Gene ENSMUSG00000021108
Gene Nameprotein kinase C, eta
SynonymsPkch
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8312 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location73584796-73778185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73760584 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 593 (F593I)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021527]
Predicted Effect probably benign
Transcript: ENSMUST00000021527
SMART Domains Protein: ENSMUSP00000021527
Gene: ENSMUSG00000021108

DomainStartEndE-ValueType
C2 11 117 1.28e-13 SMART
C1 172 222 7.92e-14 SMART
C1 246 295 2.48e-15 SMART
S_TKc 355 614 5.62e-100 SMART
S_TK_X 615 678 8.32e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119092
AA Change: F593I
SMART Domains Protein: ENSMUSP00000112499
Gene: ENSMUSG00000021108
AA Change: F593I

DomainStartEndE-ValueType
C2 11 117 1.28e-13 SMART
C1 172 222 7.92e-14 SMART
C1 246 295 2.48e-15 SMART
S_TKc 355 597 6.67e-84 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipids-dependent protein kinase. It is predominantly expressed in epithelial tissues and has been shown to reside specifically in the cell nucleus. This protein kinase can regulate keratinocyte differentiation by activating the MAP kinase MAPK13 (p38delta)-activated protein kinase cascade that targets CCAAT/enhancer-binding protein alpha (CEBPA). It is also found to mediate the transcription activation of the transglutaminase 1 (TGM1) gene. Mutations in the human gene are associated with susceptibility to cerebral infarction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit thymus hypoplasia, enlarged lymph nodes and alterations in T cell homeostasis and activation. Mice homozygous for a different knock-out allele show impaired wound healing and increased incidence of tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T C 12: 84,615,416 R23G probably damaging Het
Acnat1 A T 4: 49,449,142 L208* probably null Het
Agbl5 A G 5: 30,894,506 E556G probably damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Arih2 A G 9: 108,644,274 S2P probably damaging Het
C87436 T A 6: 86,457,831 L387Q probably damaging Het
Card9 A T 2: 26,357,789 Y183* probably null Het
Cdk14 T C 5: 4,894,141 D394G probably benign Het
Cep135 C T 5: 76,636,899 S947L probably damaging Het
Cfb T C 17: 34,858,145 K505E probably benign Het
Cnot4 T A 6: 35,023,141 D708V probably damaging Het
Col16a1 T A 4: 130,054,451 L281M unknown Het
Col6a3 G T 1: 90,813,690 D673E possibly damaging Het
Ctdnep1 G A 11: 69,988,701 S150N probably benign Het
Fam175b A G 7: 132,876,600 Y163C probably damaging Het
Fanca T A 8: 123,269,810 probably benign Het
Fras1 T A 5: 96,588,191 N548K probably benign Het
Gbp2b A G 3: 142,599,051 M83V probably benign Het
Gbp2b C A 3: 142,599,054 P84T probably damaging Het
Gli2 A T 1: 118,868,112 probably benign Het
Greb1l A G 18: 10,511,587 probably benign Het
Grn A C 11: 102,436,247 K557T probably damaging Het
Hapln1 C T 13: 89,601,444 A36V probably benign Het
Heg1 C T 16: 33,726,675 R635W probably benign Het
Hivep1 C A 13: 42,155,177 Q298K possibly damaging Het
Hmcn1 A G 1: 150,738,764 I1297T probably damaging Het
Hp1bp3 T A 4: 138,223,439 probably benign Het
Htr4 C G 18: 62,437,478 F201L probably damaging Het
Insrr C G 3: 87,800,484 Q78E possibly damaging Het
Itga6 A T 2: 71,855,953 M1072L probably benign Het
Kdsr A G 1: 106,747,486 probably null Het
Klhl7 T C 5: 24,134,967 I149T probably damaging Het
Lce1l G C 3: 92,850,459 P31A unknown Het
Mag T C 7: 30,911,469 Y116C probably damaging Het
Mast2 A G 4: 116,430,486 S131P probably benign Het
Mlec C A 5: 115,150,207 probably null Het
Mrap2 G A 9: 87,169,659 probably null Het
Myo5b A G 18: 74,733,962 K1395E probably damaging Het
Nipa2 G A 7: 55,933,302 Q232* probably null Het
Oit3 T C 10: 59,438,810 N56S probably benign Het
Olfr155 A T 4: 43,854,461 I51F probably benign Het
Olfr165 T C 16: 19,407,237 M260V probably benign Het
Olfr9 A G 10: 128,990,478 T189A probably benign Het
Pax3 C T 1: 78,195,369 R68Q probably damaging Het
Pcnx2 G T 8: 125,762,850 H1668Q possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pkd1 A G 17: 24,567,128 S463G probably benign Het
Plb1 C T 5: 32,328,485 T871M probably damaging Het
Prdx1 A G 4: 116,699,201 D182G possibly damaging Het
Psrc1 C T 3: 108,386,357 P194L probably benign Het
Ptp4a2 A T 4: 129,839,634 I18L probably benign Het
Samd10 A T 2: 181,596,875 L153H probably damaging Het
Shc3 T G 13: 51,442,718 H423P probably damaging Het
Siae A T 9: 37,646,297 I467F Het
Slc27a5 C T 7: 12,991,287 R411Q probably damaging Het
Spata24 A G 18: 35,660,808 I56T probably benign Het
Spns3 G A 11: 72,499,708 T407M probably damaging Het
Spta1 G A 1: 174,240,211 C2068Y probably damaging Het
Svs2 C A 2: 164,238,171 G25W probably damaging Het
Thsd7a T C 6: 12,471,182 D479G Het
Trhde T C 10: 114,413,287 Y858C probably damaging Het
Ttn G A 2: 76,951,648 R1057C unknown Het
Tulp4 G T 17: 6,207,058 probably null Het
Tyk2 T C 9: 21,115,649 T613A possibly damaging Het
Ugt2b37 T C 5: 87,242,940 K356R probably benign Het
Vmn1r39 A G 6: 66,804,857 V159A noncoding transcript Het
Vps35 A G 8: 85,274,869 V440A possibly damaging Het
Whsc1l1 C T 8: 25,663,252 T536M probably damaging Het
Zmym6 A G 4: 127,123,834 N1136S probably damaging Het
Other mutations in Prkch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Prkch APN 12 73702589 splice site probably benign
IGL00548:Prkch APN 12 73702811 missense probably damaging 1.00
IGL01310:Prkch APN 12 73759013 missense possibly damaging 0.78
IGL01782:Prkch APN 12 73759662 missense probably damaging 1.00
IGL02335:Prkch APN 12 73702512 missense probably benign 0.00
R0084:Prkch UTSW 12 73697987 missense possibly damaging 0.87
R0127:Prkch UTSW 12 73721787 missense possibly damaging 0.94
R0471:Prkch UTSW 12 73691652 missense probably benign 0.03
R0490:Prkch UTSW 12 73759676 missense probably damaging 1.00
R1402:Prkch UTSW 12 73585389 missense probably damaging 1.00
R1402:Prkch UTSW 12 73585389 missense probably damaging 1.00
R1552:Prkch UTSW 12 73702546 missense probably benign 0.33
R1572:Prkch UTSW 12 73649357 critical splice donor site probably null
R1651:Prkch UTSW 12 73759001 missense possibly damaging 0.88
R2114:Prkch UTSW 12 73702516 missense probably benign
R3714:Prkch UTSW 12 73775516 missense probably damaging 1.00
R4515:Prkch UTSW 12 73702838 missense possibly damaging 0.76
R4749:Prkch UTSW 12 73692960 missense probably damaging 1.00
R4977:Prkch UTSW 12 73702893 missense possibly damaging 0.52
R5381:Prkch UTSW 12 73691592 missense probably damaging 0.99
R5682:Prkch UTSW 12 73697950 missense probably damaging 1.00
R6526:Prkch UTSW 12 73702775 missense probably damaging 1.00
R6864:Prkch UTSW 12 73759617 missense probably damaging 1.00
R7484:Prkch UTSW 12 73585527 critical splice donor site probably null
R8074:Prkch UTSW 12 73700267 missense possibly damaging 0.49
R8294:Prkch UTSW 12 73759710 missense probably damaging 1.00
R8301:Prkch UTSW 12 73702764 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AAAACAGTCGGTATGGTTCTGTAAC -3'
(R):5'- TGTTCAATCCTGCAGCCTG -3'

Sequencing Primer
(F):5'- ACATTGGTATCTACTGTATGCAGAGG -3'
(R):5'- GGGGAATTCCCATCCATT -3'
Posted On2020-07-28