Incidental Mutation 'R8361:Zfp654'
ID645973
Institutional Source Beutler Lab
Gene Symbol Zfp654
Ensembl Gene ENSMUSG00000047141
Gene Namezinc finger protein 654
Synonyms1810008K20Rik, 1600021C16Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.656) question?
Stock #R8361 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location64780347-64851652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64791857 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 222 (H222R)
Ref Sequence ENSEMBL: ENSMUSP00000146656 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000207826
AA Change: H222R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,582,153 N161S possibly damaging Het
Alg2 T C 4: 47,471,848 Y320C probably damaging Het
Aox4 A T 1: 58,240,839 E538V probably benign Het
Carmil1 A C 13: 24,067,130 probably null Het
Chrd T C 16: 20,738,737 F702S possibly damaging Het
Dhx36 A T 3: 62,480,800 probably null Het
Dnah5 G T 15: 28,331,810 V2181L probably damaging Het
Dnajc11 C A 4: 151,970,911 R229S probably damaging Het
Eml3 A G 19: 8,937,437 N579D possibly damaging Het
Fam163b G A 2: 27,112,638 R116C probably benign Het
Fbxw2 A G 2: 34,807,414 C314R possibly damaging Het
Gm4847 T A 1: 166,642,270 H78L possibly damaging Het
Gtf2h3 T C 5: 124,595,668 V268A probably damaging Het
Hmbox1 T C 14: 64,896,840 S104G possibly damaging Het
Ighv1-36 T A 12: 114,880,007 S78C probably damaging Het
Lrriq3 G A 3: 155,101,218 W168* probably null Het
Mycbp2 A G 14: 103,138,814 F3981S probably damaging Het
Olfr370 A G 8: 83,542,086 H314R possibly damaging Het
Pias1 T C 9: 62,919,386 T265A possibly damaging Het
Rxfp3 C A 15: 11,036,698 R196L probably benign Het
Ryr3 A G 2: 112,653,130 S4121P probably damaging Het
Safb2 T C 17: 56,583,061 E61G probably damaging Het
Sestd1 A T 2: 77,187,228 M665K probably benign Het
Slc3a1 C T 17: 85,037,212 R269* probably null Het
Smurf1 T A 5: 144,883,696 I521F probably damaging Het
Spink5 G T 18: 43,989,462 L331F probably damaging Het
Stt3b A G 9: 115,254,920 I396T probably damaging Het
Uso1 A G 5: 92,189,262 D635G probably null Het
Usp5 C T 6: 124,824,985 G102D probably damaging Het
Zfp616 A G 11: 74,084,650 R582G probably damaging Het
Other mutations in Zfp654
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Zfp654 APN 16 64784641 missense probably benign 0.02
IGL02043:Zfp654 APN 16 64785028 missense probably benign 0.00
IGL02205:Zfp654 APN 16 64785966 missense probably damaging 1.00
IGL02337:Zfp654 APN 16 64785149 missense probably benign 0.00
IGL02398:Zfp654 APN 16 64786018 missense probably benign 0.00
R0025:Zfp654 UTSW 16 64784818 missense probably benign 0.31
R0025:Zfp654 UTSW 16 64784818 missense probably benign 0.31
R0193:Zfp654 UTSW 16 64785688 missense possibly damaging 0.76
R1276:Zfp654 UTSW 16 64785336 missense probably damaging 1.00
R1851:Zfp654 UTSW 16 64785128 missense probably benign 0.34
R4065:Zfp654 UTSW 16 64785925 missense possibly damaging 0.87
R4872:Zfp654 UTSW 16 64785782 missense probably benign 0.28
R5693:Zfp654 UTSW 16 64785926 missense probably benign 0.00
R6362:Zfp654 UTSW 16 64786094 nonsense probably null
R6483:Zfp654 UTSW 16 64791947 missense possibly damaging 0.93
R6666:Zfp654 UTSW 16 64786233 missense probably benign 0.25
R6852:Zfp654 UTSW 16 64786598 missense probably damaging 1.00
R6917:Zfp654 UTSW 16 64786471 missense probably damaging 0.98
R7289:Zfp654 UTSW 16 64785160 missense probably benign
R7506:Zfp654 UTSW 16 64791848 missense probably damaging 0.98
R7598:Zfp654 UTSW 16 64785934 missense possibly damaging 0.49
R7721:Zfp654 UTSW 16 64786207 missense probably damaging 1.00
R7791:Zfp654 UTSW 16 64783271 makesense probably null
R7884:Zfp654 UTSW 16 64851648 missense probably damaging 0.99
R7966:Zfp654 UTSW 16 64784876 missense probably damaging 1.00
Z1176:Zfp654 UTSW 16 64786208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGCCATTAATGCCTATGGG -3'
(R):5'- AAAAGTTTTCCTGTGGAGCATG -3'

Sequencing Primer
(F):5'- GCCATTAATGCCTATGGGTAAGTAG -3'
(R):5'- AAGTTCTGAAAATCCACTGT -3'
Posted On2020-09-02