Incidental Mutation 'R7966:Zfp654'
ID650394
Institutional Source Beutler Lab
Gene Symbol Zfp654
Ensembl Gene ENSMUSG00000047141
Gene Namezinc finger protein 654
Synonyms1810008K20Rik, 1600021C16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.703) question?
Stock #R7966 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location64780347-64851652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64784876 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 447 (T447A)
Ref Sequence ENSEMBL: ENSMUSP00000052946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052588] [ENSMUST00000207826]
Predicted Effect probably damaging
Transcript: ENSMUST00000052588
AA Change: T447A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052946
Gene: ENSMUSG00000047141
AA Change: T447A

DomainStartEndE-ValueType
ZnF_C2H2 25 47 1.69e-3 SMART
low complexity region 117 132 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
ZnF_C2H2 197 222 1.25e-1 SMART
ZnF_C2H2 238 260 4.65e-1 SMART
ZnF_C2H2 266 290 4.98e-1 SMART
ZnF_C2H2 295 319 7.49e0 SMART
ZnF_C2H2 534 554 1.49e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207826
AA Change: T988A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,088 Y117N probably benign Het
2700049A03Rik A T 12: 71,173,129 I817L probably benign Het
Adcy8 A T 15: 64,702,090 W1055R probably damaging Het
Anks4b A G 7: 120,182,700 E318G probably benign Het
Arid3a A G 10: 79,932,055 T229A probably benign Het
Cckar T C 5: 53,701,238 K247E possibly damaging Het
Ckap4 A G 10: 84,527,585 V538A probably damaging Het
Cped1 T C 6: 22,059,954 probably null Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cyp4v3 G T 8: 45,332,917 A21E probably benign Het
Cytip T C 2: 58,147,932 E140G probably damaging Het
D130043K22Rik A C 13: 24,893,423 Q1013P probably damaging Het
Dpp6 A G 5: 27,723,372 M763V probably benign Het
Eps15 T A 4: 109,321,143 Y193N probably damaging Het
Ghrhr T C 6: 55,379,098 W59R probably damaging Het
Hdac4 A G 1: 91,933,680 V1056A possibly damaging Het
Ipcef1 T C 10: 6,900,668 T312A probably damaging Het
Itpr3 T C 17: 27,112,028 probably null Het
Kif6 A G 17: 49,686,425 I182V probably damaging Het
Lcn3 A G 2: 25,766,377 K90E probably damaging Het
Lig3 T C 11: 82,790,516 S446P probably damaging Het
Ncln G A 10: 81,490,269 Q283* probably null Het
Nlrp4c A G 7: 6,066,323 T408A probably damaging Het
Oas1h T C 5: 120,871,899 F346L probably damaging Het
Olfr1368 A T 13: 21,142,186 Y290* probably null Het
Olfr547 T C 7: 102,535,416 I223T probably damaging Het
Olfr591 A T 7: 103,172,855 F261I probably damaging Het
Olfr922 A G 9: 38,816,240 I246V probably benign Het
Olig2 AGCCGCCGCCGCCGCCGCAGCCGCCGCCGCCGC AGCCGCCGCCGCCGCAGCCGCCGCCGCCGC 16: 91,227,074 probably benign Het
Pdcd1 A T 1: 94,041,461 V44E probably damaging Het
Prdm13 A T 4: 21,679,932 I186N unknown Het
Prpf4b A G 13: 34,901,445 D958G probably damaging Het
Prune2 A G 19: 17,178,859 N2792S probably damaging Het
Robo1 T A 16: 72,983,872 I830N possibly damaging Het
Scaper A G 9: 55,762,327 V355A probably damaging Het
Scn3b C T 9: 40,282,550 A191V probably benign Het
Slc13a3 G C 2: 165,430,235 S296C probably benign Het
Slc6a16 T A 7: 45,268,053 I445N possibly damaging Het
Snrnp35 A G 5: 124,490,502 Y126C possibly damaging Het
Spock2 A G 10: 60,121,732 H98R possibly damaging Het
Sptssb A T 3: 69,820,953 Y50* probably null Het
Syne1 A G 10: 5,116,965 probably null Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tecta A G 9: 42,394,962 F57L probably damaging Het
Tgs1 C A 4: 3,586,215 P364H probably benign Het
Tmem242 A G 17: 5,411,436 I119T probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vmn2r3 T A 3: 64,278,814 N150I probably damaging Het
Vmn2r69 A G 7: 85,411,554 I274T possibly damaging Het
Vwf T A 6: 125,639,341 L1206* probably null Het
Zfp157 T A 5: 138,447,571 W63R probably benign Het
Zfp455 T C 13: 67,199,238 Y10H probably benign Het
Zhx2 T C 15: 57,821,667 I144T probably damaging Het
Other mutations in Zfp654
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Zfp654 APN 16 64784641 missense probably benign 0.02
IGL02043:Zfp654 APN 16 64785028 missense probably benign 0.00
IGL02205:Zfp654 APN 16 64785966 missense probably damaging 1.00
IGL02337:Zfp654 APN 16 64785149 missense probably benign 0.00
IGL02398:Zfp654 APN 16 64786018 missense probably benign 0.00
R0025:Zfp654 UTSW 16 64784818 missense probably benign 0.31
R0025:Zfp654 UTSW 16 64784818 missense probably benign 0.31
R0193:Zfp654 UTSW 16 64785688 missense possibly damaging 0.76
R1276:Zfp654 UTSW 16 64785336 missense probably damaging 1.00
R1851:Zfp654 UTSW 16 64785128 missense probably benign 0.34
R4065:Zfp654 UTSW 16 64785925 missense possibly damaging 0.87
R4872:Zfp654 UTSW 16 64785782 missense probably benign 0.28
R5693:Zfp654 UTSW 16 64785926 missense probably benign 0.00
R6362:Zfp654 UTSW 16 64786094 nonsense probably null
R6483:Zfp654 UTSW 16 64791947 missense possibly damaging 0.93
R6666:Zfp654 UTSW 16 64786233 missense probably benign 0.25
R6852:Zfp654 UTSW 16 64786598 missense probably damaging 1.00
R6917:Zfp654 UTSW 16 64786471 missense probably damaging 0.98
R7289:Zfp654 UTSW 16 64785160 missense probably benign
R7506:Zfp654 UTSW 16 64791848 missense probably damaging 0.98
R7598:Zfp654 UTSW 16 64785934 missense possibly damaging 0.49
R7721:Zfp654 UTSW 16 64786207 missense probably damaging 1.00
R7791:Zfp654 UTSW 16 64783271 makesense probably null
R7884:Zfp654 UTSW 16 64851648 missense probably damaging 0.99
R8361:Zfp654 UTSW 16 64791857 missense probably damaging 1.00
Z1176:Zfp654 UTSW 16 64786208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGTTTTGGCATACTAAGGTATC -3'
(R):5'- TCCAGTTTCTACTAGTAAGTCAAGG -3'

Sequencing Primer
(F):5'- GCATACTAAGGTATCGTTCATCAAGG -3'
(R):5'- TGGAAATGAACATTCTGATGATACTG -3'
Posted On2020-09-15