Incidental Mutation 'R8367:Olfr1076'
ID646200
Institutional Source Beutler Lab
Gene Symbol Olfr1076
Ensembl Gene ENSMUSG00000060742
Gene Nameolfactory receptor 1076
SynonymsGA_x6K02T2Q125-47993761-47994702, MOR189-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R8367 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86508461-86509402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86508681 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 74 (S74L)
Ref Sequence ENSEMBL: ENSMUSP00000075612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076263]
Predicted Effect probably damaging
Transcript: ENSMUST00000076263
AA Change: S74L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075612
Gene: ENSMUSG00000060742
AA Change: S74L

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 4.6e-52 PFAM
Pfam:7tm_1 41 290 5e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G A 2: 152,442,497 probably null Het
8030423J24Rik A T 13: 70,883,977 E56V unknown Het
Abcb1a A G 5: 8,686,221 T205A probably benign Het
Aplp2 T C 9: 31,177,906 E93G probably damaging Het
Arpin T A 7: 79,929,638 N79I possibly damaging Het
Atg7 T A 6: 114,686,099 D225E probably benign Het
Cc2d2b A G 19: 40,765,975 M229V unknown Het
Cep295 C T 9: 15,334,530 V877I probably benign Het
Clca3a2 A T 3: 144,817,747 probably null Het
Cmip C T 8: 117,436,871 P359L probably benign Het
Cyb5rl A G 4: 107,070,949 Y94C probably benign Het
Cyp19a1 A G 9: 54,180,259 I125T probably damaging Het
Cyp2c54 T G 19: 40,073,681 Q44P probably damaging Het
Cyp2c67 A T 19: 39,638,674 H237Q probably benign Het
Dlgap2 A T 8: 14,843,544 Y953F probably benign Het
Hgfac G T 5: 35,045,446 C430F probably damaging Het
Kdm4b T C 17: 56,355,875 W149R probably damaging Het
Krt23 C T 11: 99,492,889 W59* probably null Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Lrrc7 T A 3: 158,202,370 Q271L possibly damaging Het
Ltc4s C A 11: 50,236,684 R108L possibly damaging Het
Mcm3ap T C 10: 76,477,859 S596P possibly damaging Het
Myot A G 18: 44,337,099 T48A probably benign Het
Mypn G C 10: 63,135,760 P834A probably damaging Het
Olfr1155 T C 2: 87,943,097 N177S possibly damaging Het
Parp14 T C 16: 35,857,754 K615E probably benign Het
Pramel6 A C 2: 87,510,470 Q382P probably damaging Het
Prdx2 A G 8: 84,971,615 D145G probably damaging Het
Prune1 A G 3: 95,265,526 V76A probably benign Het
Sppl2b A T 10: 80,863,191 H198L probably benign Het
Ttll9 C A 2: 152,994,148 H271N probably benign Het
Uhrf1bp1l T A 10: 89,805,377 D803E probably damaging Het
Vmn2r59 C A 7: 42,011,823 R856M probably benign Het
Yeats2 C T 16: 20,222,825 T1155I probably damaging Het
Zbbx A G 3: 75,081,727 probably null Het
Zfp160 A G 17: 21,025,542 D118G probably benign Het
Zfp366 A G 13: 99,244,043 M549V possibly damaging Het
Zp3r A G 1: 130,598,873 S198P probably damaging Het
Other mutations in Olfr1076
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Olfr1076 APN 2 86509169 missense possibly damaging 0.91
IGL03157:Olfr1076 APN 2 86509023 missense possibly damaging 0.95
ANU05:Olfr1076 UTSW 2 86509169 missense possibly damaging 0.91
IGL02802:Olfr1076 UTSW 2 86508946 missense probably benign
R0325:Olfr1076 UTSW 2 86509205 missense probably benign 0.14
R0384:Olfr1076 UTSW 2 86509383 missense possibly damaging 0.80
R1164:Olfr1076 UTSW 2 86508684 missense probably damaging 1.00
R1618:Olfr1076 UTSW 2 86508849 missense probably damaging 1.00
R1915:Olfr1076 UTSW 2 86508999 missense probably damaging 1.00
R1999:Olfr1076 UTSW 2 86508745 nonsense probably null
R2093:Olfr1076 UTSW 2 86509243 missense probably damaging 0.99
R3824:Olfr1076 UTSW 2 86509023 missense possibly damaging 0.95
R4259:Olfr1076 UTSW 2 86508999 missense probably damaging 1.00
R4928:Olfr1076 UTSW 2 86509125 missense probably damaging 1.00
R4981:Olfr1076 UTSW 2 86508827 missense probably damaging 1.00
R4998:Olfr1076 UTSW 2 86509355 missense probably benign 0.00
R5783:Olfr1076 UTSW 2 86508638 missense probably damaging 1.00
R6384:Olfr1076 UTSW 2 86509037 missense probably benign
R6549:Olfr1076 UTSW 2 86509382 missense probably benign 0.00
R6893:Olfr1076 UTSW 2 86508792 missense probably damaging 1.00
R7145:Olfr1076 UTSW 2 86508528 missense probably damaging 1.00
R7157:Olfr1076 UTSW 2 86509025 missense probably damaging 0.99
R7555:Olfr1076 UTSW 2 86509347 missense probably damaging 0.99
R7611:Olfr1076 UTSW 2 86509053 missense possibly damaging 0.84
R7640:Olfr1076 UTSW 2 86508943 missense possibly damaging 0.90
R7724:Olfr1076 UTSW 2 86508605 missense probably damaging 1.00
R7965:Olfr1076 UTSW 2 86508471 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATTCATCCTGGTGGGCATC -3'
(R):5'- TATGGGATTGCCACCAGGAG -3'

Sequencing Primer
(F):5'- ATCCTGGTGGGCATCACTGAC -3'
(R):5'- CAGGAGCCAACATACTCTTTTTGAC -3'
Posted On2020-09-02