Incidental Mutation 'R8385:Rell1'
ID 647108
Institutional Source Beutler Lab
Gene Symbol Rell1
Ensembl Gene ENSMUSG00000047881
Gene Name RELT-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R8385 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 63908897-63968897 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 63930518 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 136 (K136*)
Ref Sequence ENSEMBL: ENSMUSP00000118125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087327] [ENSMUST00000154169]
AlphaFold Q8K2J7
Predicted Effect probably benign
Transcript: ENSMUST00000087327
SMART Domains Protein: ENSMUSP00000084585
Gene: ENSMUSG00000047881

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000154169
AA Change: K136*
SMART Domains Protein: ENSMUSP00000118125
Gene: ENSMUSG00000047881
AA Change: K136*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:RELT 59 103 1.2e-26 PFAM
low complexity region 149 168 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930572O03Rik A T 5: 15,652,671 S203T unknown Het
4933406M09Rik A G 1: 134,390,638 K383E probably benign Het
Brap C T 5: 121,685,134 T473I probably benign Het
Cacna1e T A 1: 154,443,941 M1400L probably damaging Het
Casc1 C T 6: 145,175,192 E685K probably damaging Het
Catsper2 A G 2: 121,410,140 I127T possibly damaging Het
Dbt A T 3: 116,523,390 I72F probably damaging Het
Ddhd2 T C 8: 25,735,014 H592R probably damaging Het
Disp2 T A 2: 118,790,410 M541K probably damaging Het
Dnmbp T C 19: 43,889,651 D327G probably benign Het
Dvl1 A G 4: 155,855,580 S390G possibly damaging Het
Fam205a1 C T 4: 42,850,509 R549H possibly damaging Het
Fbxo22 A G 9: 55,213,949 D106G probably damaging Het
Gfm2 A G 13: 97,165,011 T441A probably benign Het
Gm5431 T C 11: 48,889,520 I192V probably damaging Het
Gosr1 T A 11: 76,730,141 T241S possibly damaging Het
Hk2 T C 6: 82,729,546 S792G probably benign Het
Itsn1 A C 16: 91,893,811 K1302Q unknown Het
Kif16b T C 2: 142,712,338 K847E probably benign Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Mark3 A G 12: 111,655,374 D650G possibly damaging Het
Mob3b T C 4: 34,985,980 Y186C probably damaging Het
Mphosph9 T C 5: 124,312,722 K329E probably benign Het
Mta1 A T 12: 113,131,465 M448L probably benign Het
Mterf1a A T 5: 3,891,384 N161K probably damaging Het
Myo10 T A 15: 25,804,398 I1593N probably damaging Het
Naca A G 10: 128,042,438 N1113S unknown Het
Olfr1362 T C 13: 21,611,352 I206V probably benign Het
Olfr513 T G 7: 108,755,304 Y149* probably null Het
Pcdhga1 A T 18: 37,662,096 D51V probably damaging Het
Peg3 T C 7: 6,708,083 E1380G probably damaging Het
Pkd1 G A 17: 24,575,728 V2130M possibly damaging Het
Pla2g4c C T 7: 13,329,664 P19S probably benign Het
Popdc2 G A 16: 38,362,900 V82I probably benign Het
Ppfibp2 A G 7: 107,697,687 R203G probably benign Het
Rab19 T A 6: 39,383,958 N13K probably benign Het
Raet1d T A 10: 22,370,918 D48E probably benign Het
Slc38a4 A G 15: 96,999,512 I474T probably damaging Het
Slf1 T C 13: 77,105,990 M243V probably benign Het
Spg11 A T 2: 122,097,321 S661T probably benign Het
Thra C G 11: 98,768,351 S435R probably benign Het
Tmem181a T C 17: 6,288,999 I61T probably benign Het
Ttpa G A 4: 20,028,483 G247S probably damaging Het
Usp17lb C T 7: 104,840,623 V366I possibly damaging Het
Vit A T 17: 78,619,637 Q337L probably benign Het
Vmn2r102 A G 17: 19,693,826 Y551C possibly damaging Het
Vps52 T C 17: 33,962,817 L539P probably damaging Het
Ythdc1 C A 5: 86,828,102 P529T possibly damaging Het
Zdhhc13 T C 7: 48,805,696 probably null Het
Zfp282 A T 6: 47,905,089 Y570F possibly damaging Het
Zfp872 A T 9: 22,200,111 K295N probably damaging Het
Other mutations in Rell1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Rell1 APN 5 63937814 missense probably damaging 1.00
IGL02374:Rell1 APN 5 63937808 missense possibly damaging 0.94
IGL02697:Rell1 APN 5 63927011 missense probably damaging 0.96
R0648:Rell1 UTSW 5 63924745 missense probably benign 0.05
R1471:Rell1 UTSW 5 63936085 missense probably damaging 1.00
R3177:Rell1 UTSW 5 63926987 critical splice donor site probably null
R3277:Rell1 UTSW 5 63926987 critical splice donor site probably null
R4095:Rell1 UTSW 5 63968670 missense probably benign
R4921:Rell1 UTSW 5 63936033 missense probably damaging 1.00
R4952:Rell1 UTSW 5 63939667 intron probably benign
R6294:Rell1 UTSW 5 63939705 intron probably benign
R6692:Rell1 UTSW 5 63937867 missense probably damaging 1.00
R7297:Rell1 UTSW 5 63936075 missense possibly damaging 0.86
R8078:Rell1 UTSW 5 63939721 intron probably benign
X0028:Rell1 UTSW 5 63936095 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AATTCCTGTGAGCCTGGGTC -3'
(R):5'- GATCAGAGTAACAGCATTGGC -3'

Sequencing Primer
(F):5'- AAGTGCTCTGTCATCCAGTGAGC -3'
(R):5'- GAGTAACAGCATTGGCCACCTG -3'
Posted On 2020-09-02