Incidental Mutation 'R8385:Tmem181a'
ID647140
Institutional Source Beutler Lab
Gene Symbol Tmem181a
Ensembl Gene ENSMUSG00000038141
Gene Nametransmembrane protein 181A
SynonymsTmem181, 5930418K15Rik, Gpr178, C76977
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8385 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location6256860-6308314 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6288999 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 61 (I61T)
Ref Sequence ENSEMBL: ENSMUSP00000086333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088940] [ENSMUST00000232383]
Predicted Effect probably benign
Transcript: ENSMUST00000088940
AA Change: I61T

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000086333
Gene: ENSMUSG00000038141
AA Change: I61T

DomainStartEndE-ValueType
transmembrane domain 17 36 N/A INTRINSIC
Pfam:MIG-14_Wnt-bd 127 422 1e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232383
AA Change: I102T

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The TMEM181 gene encodes a putative G protein-coupled receptor expressed on the cell surface (Carette et al., 2009 [PubMed 19965467]; Wollscheid et al., 2009 [PubMed 19349973]).[supplied by OMIM, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930572O03Rik A T 5: 15,652,671 S203T unknown Het
4933406M09Rik A G 1: 134,390,638 K383E probably benign Het
Brap C T 5: 121,685,134 T473I probably benign Het
Cacna1e T A 1: 154,443,941 M1400L probably damaging Het
Casc1 C T 6: 145,175,192 E685K probably damaging Het
Catsper2 A G 2: 121,410,140 I127T possibly damaging Het
Dbt A T 3: 116,523,390 I72F probably damaging Het
Ddhd2 T C 8: 25,735,014 H592R probably damaging Het
Disp2 T A 2: 118,790,410 M541K probably damaging Het
Dnmbp T C 19: 43,889,651 D327G probably benign Het
Dvl1 A G 4: 155,855,580 S390G possibly damaging Het
Fam205a1 C T 4: 42,850,509 R549H possibly damaging Het
Fbxo22 A G 9: 55,213,949 D106G probably damaging Het
Gfm2 A G 13: 97,165,011 T441A probably benign Het
Gm5431 T C 11: 48,889,520 I192V probably damaging Het
Gosr1 T A 11: 76,730,141 T241S possibly damaging Het
Hk2 T C 6: 82,729,546 S792G probably benign Het
Itsn1 A C 16: 91,893,811 K1302Q unknown Het
Kif16b T C 2: 142,712,338 K847E probably benign Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Mark3 A G 12: 111,655,374 D650G possibly damaging Het
Mob3b T C 4: 34,985,980 Y186C probably damaging Het
Mphosph9 T C 5: 124,312,722 K329E probably benign Het
Mta1 A T 12: 113,131,465 M448L probably benign Het
Mterf1a A T 5: 3,891,384 N161K probably damaging Het
Myo10 T A 15: 25,804,398 I1593N probably damaging Het
Naca A G 10: 128,042,438 N1113S unknown Het
Olfr1362 T C 13: 21,611,352 I206V probably benign Het
Olfr513 T G 7: 108,755,304 Y149* probably null Het
Pcdhga1 A T 18: 37,662,096 D51V probably damaging Het
Peg3 T C 7: 6,708,083 E1380G probably damaging Het
Pkd1 G A 17: 24,575,728 V2130M possibly damaging Het
Pla2g4c C T 7: 13,329,664 P19S probably benign Het
Popdc2 G A 16: 38,362,900 V82I probably benign Het
Ppfibp2 A G 7: 107,697,687 R203G probably benign Het
Rab19 T A 6: 39,383,958 N13K probably benign Het
Raet1d T A 10: 22,370,918 D48E probably benign Het
Rell1 T A 5: 63,930,518 K136* probably null Het
Slc38a4 A G 15: 96,999,512 I474T probably damaging Het
Slf1 T C 13: 77,105,990 M243V probably benign Het
Spg11 A T 2: 122,097,321 S661T probably benign Het
Thra C G 11: 98,768,351 S435R probably benign Het
Ttpa G A 4: 20,028,483 G247S probably damaging Het
Usp17lb C T 7: 104,840,623 V366I possibly damaging Het
Vit A T 17: 78,619,637 Q337L probably benign Het
Vmn2r102 A G 17: 19,693,826 Y551C possibly damaging Het
Vps52 T C 17: 33,962,817 L539P probably damaging Het
Ythdc1 C A 5: 86,828,102 P529T possibly damaging Het
Zdhhc13 T C 7: 48,805,696 probably null Het
Zfp282 A T 6: 47,905,089 Y570F possibly damaging Het
Zfp872 A T 9: 22,200,111 K295N probably damaging Het
Other mutations in Tmem181a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02071:Tmem181a APN 17 6297256 missense probably damaging 1.00
IGL03027:Tmem181a APN 17 6298219 missense probably damaging 1.00
a_team UTSW 17 6295786 missense probably damaging 0.99
abraham UTSW 17 6290599 missense probably benign 0.03
PIT4651001:Tmem181a UTSW 17 6300895 missense probably benign
R1966:Tmem181a UTSW 17 6303226 missense probably benign
R2139:Tmem181a UTSW 17 6298206 missense probably damaging 1.00
R2323:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R2324:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3001:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3002:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3003:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3034:Tmem181a UTSW 17 6280626 missense possibly damaging 0.50
R3425:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3426:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3427:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3428:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3499:Tmem181a UTSW 17 6280619 nonsense probably null
R3683:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3893:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4226:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4227:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4428:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4429:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4430:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4465:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4466:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4467:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4496:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4728:Tmem181a UTSW 17 6290599 missense probably benign 0.03
R4822:Tmem181a UTSW 17 6280665 missense probably benign 0.00
R5301:Tmem181a UTSW 17 6295795 missense possibly damaging 0.52
R5991:Tmem181a UTSW 17 6289037 missense probably damaging 1.00
R6052:Tmem181a UTSW 17 6280615 missense probably damaging 1.00
R6222:Tmem181a UTSW 17 6300917 missense probably benign 0.29
R7131:Tmem181a UTSW 17 6297972 missense probably damaging 0.98
R7231:Tmem181a UTSW 17 6297920 missense possibly damaging 0.81
R7374:Tmem181a UTSW 17 6304258 missense possibly damaging 0.85
R7437:Tmem181a UTSW 17 6303265 missense possibly damaging 0.70
R7592:Tmem181a UTSW 17 6289020 missense probably benign 0.00
R8175:Tmem181a UTSW 17 6295800 missense probably benign 0.00
R8327:Tmem181a UTSW 17 6301405 missense probably damaging 1.00
RF010:Tmem181a UTSW 17 6280703 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTTGTACCATCGCACGAAGG -3'
(R):5'- CTACATGGACCTGATAGCATGTG -3'

Sequencing Primer
(F):5'- GAAGCTAGTTCCTTGTGCTCTGC -3'
(R):5'- TGATAGCATGTGCCCAGAC -3'
Posted On2020-09-02