Incidental Mutation 'R3177:Rell1'
ID 259162
Institutional Source Beutler Lab
Gene Symbol Rell1
Ensembl Gene ENSMUSG00000047881
Gene Name RELT-like 1
Synonyms
MMRRC Submission 040615-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R3177 (G1)
Quality Score 210
Status Validated
Chromosome 5
Chromosomal Location 64066240-64126240 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 64084330 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087327] [ENSMUST00000154169]
AlphaFold Q8K2J7
Predicted Effect probably benign
Transcript: ENSMUST00000087327
SMART Domains Protein: ENSMUSP00000084585
Gene: ENSMUSG00000047881

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153089
Predicted Effect probably null
Transcript: ENSMUST00000154169
SMART Domains Protein: ENSMUSP00000118125
Gene: ENSMUSG00000047881

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:RELT 59 103 1.2e-26 PFAM
low complexity region 149 168 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154532
Meta Mutation Damage Score 0.9484 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 100% (21/21)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,314,020 (GRCm39) R553G possibly damaging Het
Adarb2 A G 13: 8,802,663 (GRCm39) N646S probably damaging Het
Adcy8 C T 15: 64,571,008 (GRCm39) G1242S probably benign Het
Ano9 T A 7: 140,684,037 (GRCm39) T543S probably damaging Het
Btnl10 A G 11: 58,813,216 (GRCm39) K282E probably benign Het
Btnl9 T C 11: 49,060,503 (GRCm39) D330G probably damaging Het
Ccdc178 G T 18: 22,200,709 (GRCm39) A416E possibly damaging Het
Cdx2 A T 5: 147,240,002 (GRCm39) S225T probably benign Het
Clca4b T C 3: 144,617,120 (GRCm39) I843M probably benign Het
Cntn4 G A 6: 106,414,925 (GRCm39) probably null Het
Cyb561 T C 11: 105,826,613 (GRCm39) probably benign Het
Cyp4f18 T C 8: 72,747,044 (GRCm39) D317G possibly damaging Het
Dennd4a G T 9: 64,796,275 (GRCm39) R767L probably damaging Het
Dgkb G A 12: 38,134,216 (GRCm39) V41M probably damaging Het
Duox1 T C 2: 122,170,597 (GRCm39) Y1206H probably damaging Het
Dync1i1 T C 6: 5,972,211 (GRCm39) probably null Het
Fbxw2 T C 2: 34,712,762 (GRCm39) T100A probably benign Het
Fcgbp C A 7: 27,791,086 (GRCm39) H782Q probably damaging Het
Flg2 A T 3: 93,122,195 (GRCm39) Q1455L unknown Het
Frrs1 T C 3: 116,692,873 (GRCm39) F49S probably damaging Het
Gli3 A T 13: 15,900,567 (GRCm39) Q1318L probably benign Het
Gm5581 C G 6: 131,143,928 (GRCm39) noncoding transcript Het
Gm5592 A G 7: 40,937,804 (GRCm39) E362G probably benign Het
Gm7104 A T 12: 88,252,498 (GRCm39) noncoding transcript Het
Gpatch2l A G 12: 86,291,089 (GRCm39) T91A possibly damaging Het
Hacd4 T C 4: 88,355,747 (GRCm39) H46R probably damaging Het
Hao2 T C 3: 98,787,644 (GRCm39) probably benign Het
Herc2 T C 7: 55,803,176 (GRCm39) V2175A probably benign Het
Hey1 T C 3: 8,729,951 (GRCm39) S169G probably benign Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Hlf T C 11: 90,236,661 (GRCm39) K199E probably damaging Het
Hpgd C A 8: 56,751,448 (GRCm39) A92E probably damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Itgad C A 7: 127,790,153 (GRCm39) H651N possibly damaging Het
Itgav A G 2: 83,606,886 (GRCm39) D409G probably damaging Het
Kif2a A G 13: 107,113,264 (GRCm39) I455T probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lamc3 G T 2: 31,798,637 (GRCm39) G448C probably damaging Het
Ltbp1 G A 17: 75,583,475 (GRCm39) G425D possibly damaging Het
Ltbp1 T A 17: 75,666,273 (GRCm39) probably null Het
Mag C T 7: 30,601,073 (GRCm39) probably null Het
Mdh1b G A 1: 63,750,690 (GRCm39) T426M possibly damaging Het
Nr1h4 G A 10: 89,314,650 (GRCm39) T282I possibly damaging Het
Nsf C T 11: 103,821,578 (GRCm39) E26K possibly damaging Het
Or4c1 C T 2: 89,133,562 (GRCm39) V125M possibly damaging Het
Or52k2 T C 7: 102,253,783 (GRCm39) V74A possibly damaging Het
Or9s27 A G 1: 92,516,535 (GRCm39) N161S probably benign Het
Padi6 A G 4: 140,462,700 (GRCm39) L307P probably damaging Het
Parp9 T C 16: 35,768,578 (GRCm39) S20P probably damaging Het
Pdcd11 T C 19: 47,101,703 (GRCm39) F963L probably damaging Het
Pwp1 C T 10: 85,717,943 (GRCm39) L294F probably benign Het
Radil A G 5: 142,492,611 (GRCm39) L339P probably damaging Het
Raver1 G A 9: 20,990,573 (GRCm39) P316S possibly damaging Het
Rxrg A G 1: 167,463,269 (GRCm39) D257G possibly damaging Het
Sema4c C T 1: 36,588,960 (GRCm39) R722H possibly damaging Het
Sgk1 C T 10: 21,872,500 (GRCm39) R171W probably damaging Het
Spata7 A G 12: 98,603,857 (GRCm39) N75D possibly damaging Het
Ttc23l A G 15: 10,547,318 (GRCm39) F99L possibly damaging Het
Unc13a A C 8: 72,082,339 (GRCm39) C1642G probably benign Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Wrn A G 8: 33,807,582 (GRCm39) M292T probably damaging Het
Zfp423 A G 8: 88,508,959 (GRCm39) Y462H probably damaging Het
Zscan5b T A 7: 6,234,345 (GRCm39) Y124N possibly damaging Het
Zswim9 T C 7: 13,011,196 (GRCm39) T51A possibly damaging Het
Other mutations in Rell1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Rell1 APN 5 64,095,157 (GRCm39) missense probably damaging 1.00
IGL02374:Rell1 APN 5 64,095,151 (GRCm39) missense possibly damaging 0.94
IGL02697:Rell1 APN 5 64,084,354 (GRCm39) missense probably damaging 0.96
R0648:Rell1 UTSW 5 64,082,088 (GRCm39) missense probably benign 0.05
R1471:Rell1 UTSW 5 64,093,428 (GRCm39) missense probably damaging 1.00
R3277:Rell1 UTSW 5 64,084,330 (GRCm39) critical splice donor site probably null
R4095:Rell1 UTSW 5 64,126,013 (GRCm39) missense probably benign
R4921:Rell1 UTSW 5 64,093,376 (GRCm39) missense probably damaging 1.00
R4952:Rell1 UTSW 5 64,097,010 (GRCm39) intron probably benign
R6294:Rell1 UTSW 5 64,097,048 (GRCm39) intron probably benign
R6692:Rell1 UTSW 5 64,095,210 (GRCm39) missense probably damaging 1.00
R7297:Rell1 UTSW 5 64,093,418 (GRCm39) missense possibly damaging 0.86
R8078:Rell1 UTSW 5 64,097,064 (GRCm39) intron probably benign
R8385:Rell1 UTSW 5 64,087,861 (GRCm39) nonsense probably null
R9227:Rell1 UTSW 5 64,097,105 (GRCm39) intron probably benign
R9230:Rell1 UTSW 5 64,097,105 (GRCm39) intron probably benign
X0028:Rell1 UTSW 5 64,093,438 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTGGGCTCCATCTATTTACAGAG -3'
(R):5'- GGGAAGCATGTCTGTGGTCATC -3'

Sequencing Primer
(F):5'- ACTTGTTCTCTATGAGCTATCAAGAG -3'
(R):5'- GTGGTCATCATCTGCACACAGTG -3'
Posted On 2015-01-23