Incidental Mutation 'R8398:Scrn2'
ID647728
Institutional Source Beutler Lab
Gene Symbol Scrn2
Ensembl Gene ENSMUSG00000020877
Gene Namesecernin 2
SynonymsSES2, D11Moh48
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8398 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location97029938-97033958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 97030904 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 67 (V67L)
Ref Sequence ENSEMBL: ENSMUSP00000021249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021249] [ENSMUST00000021251] [ENSMUST00000153482]
Predicted Effect probably benign
Transcript: ENSMUST00000021249
AA Change: V67L

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000021249
Gene: ENSMUSG00000020877
AA Change: V67L

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Peptidase_C69 83 254 2e-10 PFAM
coiled coil region 362 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021251
SMART Domains Protein: ENSMUSP00000021251
Gene: ENSMUSG00000020878

DomainStartEndE-ValueType
SCOP:d1h6ua2 44 150 1e-15 SMART
Blast:LRR 69 91 7e-6 BLAST
low complexity region 179 191 N/A INTRINSIC
low complexity region 209 225 N/A INTRINSIC
low complexity region 265 292 N/A INTRINSIC
low complexity region 297 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153482
AA Change: V67L

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000116606
Gene: ENSMUSG00000020877
AA Change: V67L

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Peptidase_C69 59 181 2.4e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,182,678 D6086G probably damaging Het
Amh T C 10: 80,805,560 S105P probably benign Het
Arap2 A T 5: 62,748,909 Y256N probably damaging Het
Asap3 G A 4: 136,234,393 M271I probably benign Het
Bbof1 T C 12: 84,428,414 L459P probably damaging Het
Ccl21a T C 4: 42,773,412 T109A probably benign Het
Cnot6 C T 11: 49,702,618 R12Q probably damaging Het
D5Ertd579e G A 5: 36,614,277 Q925* probably null Het
Dbh G A 2: 27,174,898 V374M probably damaging Het
Dvl2 T A 11: 70,008,302 L462Q probably damaging Het
Fchsd1 G A 18: 37,966,524 R206C probably damaging Het
Gjd4 C T 18: 9,280,326 V251M possibly damaging Het
Glud1 A G 14: 34,311,271 D125G probably benign Het
Gm10428 T C 11: 62,753,347 I83T unknown Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gm3045 A G 13: 56,429,467 T143A possibly damaging Het
Heatr6 A C 11: 83,781,338 E1057D probably benign Het
Hoxa9 T C 6: 52,224,423 T213A probably damaging Het
Hsd3b5 T A 3: 98,619,404 D242V possibly damaging Het
Lama5 A G 2: 180,197,034 probably null Het
Lrp1b C T 2: 40,701,807 C3827Y Het
Mast2 A T 4: 116,308,749 S1261T probably damaging Het
Mex3b T A 7: 82,869,634 F386I probably benign Het
Mta1 T A 12: 113,131,622 M465K possibly damaging Het
Mtmr12 T A 15: 12,265,609 F470L probably damaging Het
Myot A G 18: 44,354,816 N400S probably benign Het
Ndnf T C 6: 65,704,378 V547A probably damaging Het
Noc3l A T 19: 38,795,110 D607E probably benign Het
Olfr1137 A G 2: 87,711,831 V25A probably benign Het
Pcdha11 G A 18: 37,013,063 G736R possibly damaging Het
Pcgf3 A G 5: 108,499,643 N205S probably damaging Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Psg27 T C 7: 18,561,912 T203A probably benign Het
Ptch1 T C 13: 63,525,125 T889A probably benign Het
Sars C T 3: 108,428,173 probably null Het
Slc1a4 T C 11: 20,307,982 D380G probably damaging Het
Slc9a1 A T 4: 133,419,503 Q516L probably benign Het
Smc4 T C 3: 69,025,851 Y627H probably damaging Het
Spon2 G T 5: 33,216,810 H76Q probably damaging Het
Sppl2b CTGTCACA C 10: 80,866,068 probably null Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Sugp1 A G 8: 70,071,133 Y550C probably damaging Het
Sun1 A G 5: 139,236,653 D558G probably damaging Het
Syne1 T C 10: 5,124,923 E1134G probably damaging Het
Thbd C T 2: 148,406,680 V423I probably benign Het
V1rd19 C A 7: 24,003,949 S280* probably null Het
Zfp947 A T 17: 22,146,121 C191S probably benign Het
Other mutations in Scrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Scrn2 APN 11 97030570 missense probably benign 0.03
IGL01580:Scrn2 APN 11 97032130 missense probably benign
R1847:Scrn2 UTSW 11 97032195 missense probably benign 0.22
R2509:Scrn2 UTSW 11 97033166 missense possibly damaging 0.71
R2698:Scrn2 UTSW 11 97032296 unclassified probably benign
R4361:Scrn2 UTSW 11 97032238 missense probably null 1.00
R4927:Scrn2 UTSW 11 97033500 critical splice donor site probably null
R5040:Scrn2 UTSW 11 97030883 missense probably damaging 1.00
R5367:Scrn2 UTSW 11 97033127 missense possibly damaging 0.95
R5534:Scrn2 UTSW 11 97030925 missense probably benign 0.00
R6145:Scrn2 UTSW 11 97032853 missense probably benign 0.35
R7029:Scrn2 UTSW 11 97030436 unclassified probably benign
R7082:Scrn2 UTSW 11 97033082 missense possibly damaging 0.68
R7165:Scrn2 UTSW 11 97033808 missense probably benign
R7468:Scrn2 UTSW 11 97033166 missense possibly damaging 0.95
R7568:Scrn2 UTSW 11 97030886 missense probably damaging 1.00
R7632:Scrn2 UTSW 11 97033142 missense possibly damaging 0.51
R7950:Scrn2 UTSW 11 97030929 missense probably damaging 1.00
R8239:Scrn2 UTSW 11 97032220 missense probably damaging 1.00
R8408:Scrn2 UTSW 11 97031043 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTGAGTGGAGTTAGCTTC -3'
(R):5'- CCCAATAGACTCAGGCTAGGTG -3'

Sequencing Primer
(F):5'- CTGCTAACTCGGTTTACTTATGTG -3'
(R):5'- CTCAGGCTAGGTGGGAGG -3'
Posted On2020-09-02