Incidental Mutation 'R7950:Scrn2'
ID649516
Institutional Source Beutler Lab
Gene Symbol Scrn2
Ensembl Gene ENSMUSG00000020877
Gene Namesecernin 2
SynonymsSES2, D11Moh48
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7950 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location97029938-97033958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97030929 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 75 (L75Q)
Ref Sequence ENSEMBL: ENSMUSP00000021249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021249] [ENSMUST00000021251] [ENSMUST00000153482]
Predicted Effect probably damaging
Transcript: ENSMUST00000021249
AA Change: L75Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021249
Gene: ENSMUSG00000020877
AA Change: L75Q

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Peptidase_C69 83 254 2e-10 PFAM
coiled coil region 362 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021251
SMART Domains Protein: ENSMUSP00000021251
Gene: ENSMUSG00000020878

DomainStartEndE-ValueType
SCOP:d1h6ua2 44 150 1e-15 SMART
Blast:LRR 69 91 7e-6 BLAST
low complexity region 179 191 N/A INTRINSIC
low complexity region 209 225 N/A INTRINSIC
low complexity region 265 292 N/A INTRINSIC
low complexity region 297 323 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153482
AA Change: L75Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116606
Gene: ENSMUSG00000020877
AA Change: L75Q

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Peptidase_C69 59 181 2.4e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,979,767 T31I probably damaging Het
Adgrf5 G A 17: 43,451,157 V1248M probably damaging Het
Alb T C 5: 90,472,464 S478P probably damaging Het
Arhgap17 A G 7: 123,286,816 S698P probably benign Het
Arhgef5 A G 6: 43,273,925 T537A possibly damaging Het
Atp13a4 A T 16: 29,449,917 W540R Het
Birc6 A T 17: 74,593,100 D1091V probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
C1ql4 T A 15: 99,084,812 H220L probably benign Het
Cacna1s A G 1: 136,100,625 N1147S probably benign Het
Cc2d2a T C 5: 43,695,296 probably null Het
Ccdc155 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC 7: 45,188,184 probably benign Het
Ccdc155 AGGCTC AGGCTCGGGCTC 7: 45,188,196 probably benign Het
Ccdc155 TCAGGC TCAGGCGCAGGC 7: 45,188,218 probably benign Het
Ccdc36 T C 9: 108,405,671 T273A probably benign Het
Ccl1 T A 11: 82,179,693 I18L probably benign Het
Ecel1 A T 1: 87,148,269 Y729N probably damaging Het
Epha4 T A 1: 77,507,196 I59F probably damaging Het
Filip1l A G 16: 57,569,711 K221E probably damaging Het
Flnc A G 6: 29,456,382 E2193G possibly damaging Het
Galnt10 C G 11: 57,783,723 P513A probably damaging Het
Gm5624 A G 14: 44,560,733 Y139H Het
Golgb1 A C 16: 36,915,424 I1719L probably benign Het
Hsf1 T C 15: 76,498,193 S255P probably benign Het
Ighv2-2 T C 12: 113,588,294 D108G probably damaging Het
Kbtbd3 C T 9: 4,316,878 Q10* probably null Het
Kcnh2 C T 5: 24,333,036 V110M probably benign Het
Magi3 A C 3: 104,016,689 L1112W probably damaging Het
Malrd1 T A 2: 16,128,068 D1933E unknown Het
Mki67 G A 7: 135,699,724 R1194* probably null Het
Nap1l1 T C 10: 111,492,908 Y233H probably damaging Het
Napsa A G 7: 44,585,334 I298V probably benign Het
Nkx6-1 A T 5: 101,663,599 S212R probably damaging Het
Nlrc4 A T 17: 74,445,615 I591N probably damaging Het
Olfr1468-ps1 T C 19: 13,375,067 I35T possibly damaging Het
Orc2 T C 1: 58,467,668 D503G possibly damaging Het
Osbp T A 19: 11,978,248 S343T probably benign Het
Pcdha6 T G 18: 36,969,426 D557E probably damaging Het
Pdcd11 AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 19: 47,113,437 probably benign Het
Ppdpf A G 2: 181,187,857 Y35C probably benign Het
Scube3 G A 17: 28,171,226 V955I probably benign Het
Slc1a1 T C 19: 28,911,761 V478A probably benign Het
Srrm2 T C 17: 23,808,110 L96P unknown Het
Strn A T 17: 78,670,423 L175Q Het
Other mutations in Scrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Scrn2 APN 11 97030570 missense probably benign 0.03
IGL01580:Scrn2 APN 11 97032130 missense probably benign
R1847:Scrn2 UTSW 11 97032195 missense probably benign 0.22
R2509:Scrn2 UTSW 11 97033166 missense possibly damaging 0.71
R2698:Scrn2 UTSW 11 97032296 unclassified probably benign
R4361:Scrn2 UTSW 11 97032238 missense probably null 1.00
R4927:Scrn2 UTSW 11 97033500 critical splice donor site probably null
R5040:Scrn2 UTSW 11 97030883 missense probably damaging 1.00
R5367:Scrn2 UTSW 11 97033127 missense possibly damaging 0.95
R5534:Scrn2 UTSW 11 97030925 missense probably benign 0.00
R6145:Scrn2 UTSW 11 97032853 missense probably benign 0.35
R7029:Scrn2 UTSW 11 97030436 unclassified probably benign
R7082:Scrn2 UTSW 11 97033082 missense possibly damaging 0.68
R7165:Scrn2 UTSW 11 97033808 missense probably benign
R7468:Scrn2 UTSW 11 97033166 missense possibly damaging 0.95
R7568:Scrn2 UTSW 11 97030886 missense probably damaging 1.00
R7632:Scrn2 UTSW 11 97033142 missense possibly damaging 0.51
R8239:Scrn2 UTSW 11 97032220 missense probably damaging 1.00
R8398:Scrn2 UTSW 11 97030904 missense probably benign 0.07
R8408:Scrn2 UTSW 11 97031043 missense not run
Predicted Primers PCR Primer
(F):5'- ACCCTTGAGTGGAGTTAGCTTC -3'
(R):5'- CCAATAGACTCAGGCTAGGTGG -3'

Sequencing Primer
(F):5'- AACTCGGTTTACTTATGTGTGACC -3'
(R):5'- CTCAGGCTAGGTGGGAGGAAG -3'
Posted On2020-09-15