Incidental Mutation 'R7915:Fam149a'
ID648020
Institutional Source Beutler Lab
Gene Symbol Fam149a
Ensembl Gene ENSMUSG00000070044
Gene Namefamily with sequence similarity 149, member A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7915 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location45336717-45382291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45341243 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 708 (M708I)
Ref Sequence ENSEMBL: ENSMUSP00000091245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093526] [ENSMUST00000155230]
Predicted Effect probably benign
Transcript: ENSMUST00000093526
AA Change: M708I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091245
Gene: ENSMUSG00000070044
AA Change: M708I

DomainStartEndE-ValueType
low complexity region 48 65 N/A INTRINSIC
low complexity region 96 111 N/A INTRINSIC
low complexity region 239 250 N/A INTRINSIC
low complexity region 262 274 N/A INTRINSIC
Pfam:DUF3719 305 370 4.3e-30 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000120196
Gene: ENSMUSG00000070044
AA Change: M664I

DomainStartEndE-ValueType
low complexity region 59 85 N/A INTRINSIC
low complexity region 90 108 N/A INTRINSIC
low complexity region 193 204 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
Pfam:DUF3719 259 324 2.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155230
AA Change: M627I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114612
Gene: ENSMUSG00000070044
AA Change: M627I

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 55 73 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
Pfam:DUF3719 224 291 5.8e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T C 8: 11,678,645 T9A possibly damaging Het
Abca17 T G 17: 24,265,533 H1585P probably damaging Het
Acaca A T 11: 84,276,588 T1063S probably benign Het
Actc1 T A 2: 114,050,486 K86M probably damaging Het
Amz1 A G 5: 140,741,435 N51S probably benign Het
Arhgap33 G A 7: 30,523,223 P1095S probably benign Het
Bicra T C 7: 15,988,522 T357A probably benign Het
C130032M10Rik A G 9: 114,516,055 R120G unknown Het
Cadps A G 14: 12,705,544 F284L possibly damaging Het
Ccdc83 G A 7: 90,244,082 Q156* probably null Het
Cdh20 T A 1: 104,934,173 M26K probably benign Het
Cdh23 A G 10: 60,307,889 L2979P probably damaging Het
Crocc2 T C 1: 93,213,641 L1172P probably damaging Het
Cyp2d10 C T 15: 82,404,427 probably null Het
Cyp2j9 T A 4: 96,591,384 probably benign Het
Dgcr2 A G 16: 17,859,402 probably null Het
Dio3 A G 12: 110,280,039 M270V Het
Dll1 C A 17: 15,368,428 D662Y probably damaging Het
Drd1 G T 13: 54,053,815 P127T probably damaging Het
Evc2 T C 5: 37,386,862 S652P probably damaging Het
Fam89a T C 8: 124,741,156 E139G probably damaging Het
Gm13088 T C 4: 143,655,745 K127R possibly damaging Het
Gm28710 A G 5: 16,827,014 N556D probably benign Het
Gpr141 T C 13: 19,752,559 I15M probably benign Het
Hcn4 G A 9: 58,823,935 E142K unknown Het
Hivep3 T A 4: 120,097,765 S1093T possibly damaging Het
Inpp5f C A 7: 128,667,709 T261K probably benign Het
Ints3 A T 3: 90,432,825 D42E probably benign Het
Krt90 A T 15: 101,558,403 probably null Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lrig1 C A 6: 94,630,101 probably null Het
Mapk14 A G 17: 28,728,954 T221A probably benign Het
Megf10 A T 18: 57,240,735 T202S probably benign Het
Neo1 A T 9: 58,930,981 F507I probably benign Het
Olfr1084 T A 2: 86,638,766 *314L probably null Het
Olfr1351 A G 10: 79,017,430 Y36C probably damaging Het
Olfr912 A T 9: 38,581,673 Y132F probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pkd1 T A 17: 24,592,656 Y3724* probably null Het
Plxnd1 T C 6: 115,966,918 D1140G probably benign Het
Prex1 A G 2: 166,621,192 S250P probably damaging Het
Prom1 A T 5: 44,004,935 M777K possibly damaging Het
Prrc2c A C 1: 162,692,408 S2125A probably benign Het
Ptpn12 A G 5: 21,009,451 I229T probably damaging Het
Ranbp6 A G 19: 29,812,673 V93A probably benign Het
Rtn3 A G 19: 7,457,500 C376R probably benign Het
Sis A C 3: 72,921,138 H1201Q probably damaging Het
Slc20a1 G A 2: 129,207,837 D340N probably benign Het
Slc3a2 G A 19: 8,707,818 R535W probably damaging Het
Slc5a2 T A 7: 128,265,794 L33Q probably damaging Het
Sltm G T 9: 70,587,149 R927L probably damaging Het
Stat1 A G 1: 52,151,281 D565G probably benign Het
Terb1 T C 8: 104,447,216 K745R possibly damaging Het
Tescl T C 7: 24,333,688 I71V probably damaging Het
Tgm1 T C 14: 55,700,426 D742G probably damaging Het
Tmem128 T A 5: 38,266,531 W30R probably benign Het
Tox T A 4: 6,822,949 M123L probably benign Het
Tsnaxip1 A G 8: 105,842,781 S547G possibly damaging Het
Ttn T A 2: 76,737,195 K27785* probably null Het
Usp38 A C 8: 81,001,083 S340R probably damaging Het
Utrn A T 10: 12,465,212 H2840Q probably damaging Het
Vars2 T C 17: 35,664,839 I229V probably damaging Het
Vmn1r16 A T 6: 57,323,395 Y81N probably damaging Het
Vmn2r98 A T 17: 19,067,231 D442V probably benign Het
Vps13d T C 4: 145,086,819 I3296V Het
Wwtr1 A G 3: 57,575,599 probably null Het
Zcchc6 T C 13: 59,784,814 I1345V probably benign Het
Other mutations in Fam149a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Fam149a APN 8 45339343 missense probably damaging 1.00
IGL00229:Fam149a APN 8 45351786 missense probably damaging 0.98
IGL01089:Fam149a APN 8 45348527 missense possibly damaging 0.95
IGL01578:Fam149a APN 8 45350442 missense probably damaging 1.00
IGL03095:Fam149a APN 8 45341228 missense probably damaging 1.00
IGL03112:Fam149a APN 8 45348543 missense possibly damaging 0.78
guangxi UTSW 8 45381741 missense probably damaging 1.00
PIT1430001:Fam149a UTSW 8 45351706 missense probably benign 0.00
R0111:Fam149a UTSW 8 45341146 splice site probably benign
R0113:Fam149a UTSW 8 45341024 missense probably damaging 1.00
R0452:Fam149a UTSW 8 45355649 missense probably damaging 1.00
R0604:Fam149a UTSW 8 45345008 missense probably damaging 1.00
R1441:Fam149a UTSW 8 45355647 missense probably damaging 1.00
R1672:Fam149a UTSW 8 45339374 critical splice acceptor site probably null
R1861:Fam149a UTSW 8 45339362 nonsense probably null
R1981:Fam149a UTSW 8 45381741 missense probably damaging 1.00
R2173:Fam149a UTSW 8 45353954 missense probably damaging 1.00
R2211:Fam149a UTSW 8 45341009 missense probably damaging 0.99
R3807:Fam149a UTSW 8 45381610 missense possibly damaging 0.91
R4176:Fam149a UTSW 8 45341284 missense probably benign 0.41
R4913:Fam149a UTSW 8 45353883 missense probably damaging 1.00
R5158:Fam149a UTSW 8 45350435 missense possibly damaging 0.51
R5172:Fam149a UTSW 8 45344653 missense probably damaging 0.99
R5436:Fam149a UTSW 8 45348471 missense probably benign 0.21
R6060:Fam149a UTSW 8 45358762 intron probably benign
R6426:Fam149a UTSW 8 45381574 missense probably benign
R6590:Fam149a UTSW 8 45349034 missense probably damaging 1.00
R6596:Fam149a UTSW 8 45381630 missense probably benign 0.25
R6690:Fam149a UTSW 8 45349034 missense probably damaging 1.00
R6730:Fam149a UTSW 8 45381174 missense probably damaging 1.00
R6734:Fam149a UTSW 8 45381441 missense probably benign
R6916:Fam149a UTSW 8 45350406 missense probably damaging 1.00
R7088:Fam149a UTSW 8 45350545 missense probably benign 0.08
R7219:Fam149a UTSW 8 45350563 missense possibly damaging 0.94
R7352:Fam149a UTSW 8 45340997 missense probably damaging 0.98
R7454:Fam149a UTSW 8 45348546 missense probably benign 0.29
R7591:Fam149a UTSW 8 45350435 missense possibly damaging 0.89
R7788:Fam149a UTSW 8 45381517 missense probably damaging 1.00
R7846:Fam149a UTSW 8 45358641 missense
R8036:Fam149a UTSW 8 45349011 missense probably benign 0.00
R8181:Fam149a UTSW 8 45381718 missense possibly damaging 0.92
R8239:Fam149a UTSW 8 45350453 missense possibly damaging 0.48
R8246:Fam149a UTSW 8 45381618 missense probably benign 0.00
R8532:Fam149a UTSW 8 45348954 missense possibly damaging 0.80
R8856:Fam149a UTSW 8 45381574 missense
Z1176:Fam149a UTSW 8 45342458 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGTCAGGGAGCCTTTTCGAG -3'
(R):5'- CCTTAACACAGCTAGCAATGTGTC -3'

Sequencing Primer
(F):5'- TGTGTCTGACTGTCAGGAGAAAG -3'
(R):5'- CAGCTAGCAATGTGTCAATGAAAATG -3'
Posted On2020-09-15