Incidental Mutation 'R1981:Fam149a'
ID 222321
Institutional Source Beutler Lab
Gene Symbol Fam149a
Ensembl Gene ENSMUSG00000070044
Gene Name family with sequence similarity 149, member A
MMRRC Submission 039993-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1981 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 45336717-45382291 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 45381741 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 7 (D7A)
Ref Sequence ENSEMBL: ENSMUSP00000091245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093526]
AlphaFold Q8CFV2
Predicted Effect probably damaging
Transcript: ENSMUST00000093526
AA Change: D7A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091245
Gene: ENSMUSG00000070044
AA Change: D7A

low complexity region 48 65 N/A INTRINSIC
low complexity region 96 111 N/A INTRINSIC
low complexity region 239 250 N/A INTRINSIC
low complexity region 262 274 N/A INTRINSIC
Pfam:DUF3719 305 370 4.3e-30 PFAM
Meta Mutation Damage Score 0.2239 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atad1 G T 19: 32,695,810 D224E probably benign Het
Atp1a3 T G 7: 25,000,975 E33A probably benign Het
Baz2b A G 2: 59,923,680 F1100L possibly damaging Het
Car7 C T 8: 104,548,377 probably benign Het
Casp8 C A 1: 58,828,962 probably null Het
Cdh23 A T 10: 60,378,751 L1495H probably damaging Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Col16a1 C G 4: 130,065,443 P346A unknown Het
Cyp2c29 A G 19: 39,307,772 probably null Het
Cyp3a13 T C 5: 137,911,856 S139G probably damaging Het
Dapk2 A G 9: 66,268,898 H327R probably benign Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dnah2 A G 11: 69,474,325 Y1944H probably damaging Het
Dnaic2 T A 11: 114,732,929 V6E probably damaging Het
Eipr1 T C 12: 28,863,025 Y242H probably damaging Het
Fam217a T A 13: 34,916,754 D140V probably benign Het
Fat4 G A 3: 38,991,664 C3944Y probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Gcsam A T 16: 45,619,974 T127S probably damaging Het
Git2 C T 5: 114,749,559 probably benign Het
Gm1527 T C 3: 28,915,835 probably null Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gtf3c1 A G 7: 125,644,272 L1720P possibly damaging Het
Hat1 A G 2: 71,389,977 T28A probably benign Het
Igf2r G A 17: 12,733,903 Q219* probably null Het
Impdh1 T A 6: 29,206,451 D129V possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Ltbp3 A G 19: 5,758,079 Q1250R probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mast2 T C 4: 116,314,840 Y569C probably damaging Het
Mcoln3 A T 3: 146,140,590 K552* probably null Het
Mctp2 T C 7: 72,164,698 Q601R probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Myo19 A T 11: 84,892,170 Q170L possibly damaging Het
Myo1h T C 5: 114,353,837 F676S probably damaging Het
Myo9a A G 9: 59,894,146 T1876A probably benign Het
Nav3 G T 10: 109,719,090 probably benign Het
Ndor1 T C 2: 25,255,224 Y43C probably damaging Het
Nlrp1a A G 11: 71,098,938 V1102A probably damaging Het
Nmnat3 T C 9: 98,410,299 I199T possibly damaging Het
Nsun7 T C 5: 66,261,214 S96P probably damaging Het
Ntng1 A G 3: 109,935,010 V149A possibly damaging Het
Oas3 T C 5: 120,761,835 probably benign Het
Olfr1055 A T 2: 86,347,142 I208N possibly damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Olfr1350 A G 7: 6,570,558 D189G probably benign Het
Olfr1418 T G 19: 11,855,007 Q315H possibly damaging Het
Olfr147 T C 9: 38,403,735 L287P probably damaging Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Pax2 G A 19: 44,818,465 D301N probably damaging Het
Pcsk4 T A 10: 80,325,779 E176V probably damaging Het
Pkhd1 G A 1: 20,117,060 P3675S probably benign Het
Plekho2 A T 9: 65,558,692 L138Q probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr11 T A 11: 87,103,290 D100V probably damaging Het
Qars A G 9: 108,515,028 N136D probably damaging Het
Rbm15b A G 9: 106,881,623 probably benign Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rsrc1 A G 3: 67,350,005 D250G probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Scn2a C A 2: 65,690,170 N503K probably damaging Het
Sh2d6 G A 6: 72,517,544 probably benign Het
Smg8 T C 11: 87,085,331 T475A probably benign Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Tbx20 T A 9: 24,770,913 K48N possibly damaging Het
Tead1 C A 7: 112,891,745 D231E probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tjp1 A T 7: 65,312,855 F1111L probably damaging Het
Tlr11 T A 14: 50,361,988 I477K possibly damaging Het
Ttc13 A G 8: 124,714,187 probably null Het
Ttc17 T C 2: 94,326,704 N411S probably benign Het
Usp15 T A 10: 123,125,041 probably benign Het
Usp18 A G 6: 121,252,517 K32E probably benign Het
Vmn1r12 A T 6: 57,159,661 M248L probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp930 T A 8: 69,228,172 L172H probably damaging Het
Zfp976 G A 7: 42,613,622 H264Y probably damaging Het
Other mutations in Fam149a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Fam149a APN 8 45339343 missense probably damaging 1.00
IGL00229:Fam149a APN 8 45351786 missense probably damaging 0.98
IGL01089:Fam149a APN 8 45348527 missense possibly damaging 0.95
IGL01578:Fam149a APN 8 45350442 missense probably damaging 1.00
IGL03095:Fam149a APN 8 45341228 missense probably damaging 1.00
IGL03112:Fam149a APN 8 45348543 missense possibly damaging 0.78
guangxi UTSW 8 45381741 missense probably damaging 1.00
PIT1430001:Fam149a UTSW 8 45351706 missense probably benign 0.00
R0111:Fam149a UTSW 8 45341146 splice site probably benign
R0113:Fam149a UTSW 8 45341024 missense probably damaging 1.00
R0452:Fam149a UTSW 8 45355649 missense probably damaging 1.00
R0604:Fam149a UTSW 8 45345008 missense probably damaging 1.00
R1441:Fam149a UTSW 8 45355647 missense probably damaging 1.00
R1672:Fam149a UTSW 8 45339374 critical splice acceptor site probably null
R1861:Fam149a UTSW 8 45339362 nonsense probably null
R2173:Fam149a UTSW 8 45353954 missense probably damaging 1.00
R2211:Fam149a UTSW 8 45341009 missense probably damaging 0.99
R3807:Fam149a UTSW 8 45381610 missense possibly damaging 0.91
R4176:Fam149a UTSW 8 45341284 missense probably benign 0.41
R4913:Fam149a UTSW 8 45353883 missense probably damaging 1.00
R5158:Fam149a UTSW 8 45350435 missense possibly damaging 0.51
R5172:Fam149a UTSW 8 45344653 missense probably damaging 0.99
R5436:Fam149a UTSW 8 45348471 missense probably benign 0.21
R6060:Fam149a UTSW 8 45358762 intron probably benign
R6426:Fam149a UTSW 8 45381574 missense probably benign
R6590:Fam149a UTSW 8 45349034 missense probably damaging 1.00
R6596:Fam149a UTSW 8 45381630 missense probably benign 0.25
R6690:Fam149a UTSW 8 45349034 missense probably damaging 1.00
R6730:Fam149a UTSW 8 45381174 missense probably damaging 1.00
R6734:Fam149a UTSW 8 45381441 missense probably benign
R6916:Fam149a UTSW 8 45350406 missense probably damaging 1.00
R7088:Fam149a UTSW 8 45350545 missense probably benign 0.08
R7219:Fam149a UTSW 8 45350563 missense possibly damaging 0.94
R7352:Fam149a UTSW 8 45340997 missense probably damaging 0.98
R7454:Fam149a UTSW 8 45348546 missense probably benign 0.29
R7591:Fam149a UTSW 8 45350435 missense possibly damaging 0.89
R7788:Fam149a UTSW 8 45381517 missense probably damaging 1.00
R7846:Fam149a UTSW 8 45358641 missense
R7915:Fam149a UTSW 8 45341243 missense probably benign
R8036:Fam149a UTSW 8 45349011 missense probably benign 0.00
R8181:Fam149a UTSW 8 45381718 missense possibly damaging 0.92
R8239:Fam149a UTSW 8 45350453 missense possibly damaging 0.48
R8246:Fam149a UTSW 8 45381618 missense probably benign 0.00
R8532:Fam149a UTSW 8 45348954 missense possibly damaging 0.80
R8856:Fam149a UTSW 8 45381574 missense
R8986:Fam149a UTSW 8 45358800 missense
R9448:Fam149a UTSW 8 45339374 critical splice acceptor site probably null
Z1176:Fam149a UTSW 8 45342458 missense possibly damaging 0.92
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-08-25