Incidental Mutation 'R8489:Snapc3'
ID 657875
Institutional Source Beutler Lab
Gene Symbol Snapc3
Ensembl Gene ENSMUSG00000028483
Gene Name small nuclear RNA activating complex, polypeptide 3
Synonyms 4930558A07Rik, E030018J20Rik, 5031401C21Rik, 1810020H02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.972) question?
Stock # R8489 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 83417724-83467676 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 83451294 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 353 (C353Y)
Ref Sequence ENSEMBL: ENSMUSP00000123793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030206] [ENSMUST00000030207] [ENSMUST00000123262] [ENSMUST00000124856] [ENSMUST00000137512] [ENSMUST00000143533]
AlphaFold Q9D2C9
Predicted Effect probably damaging
Transcript: ENSMUST00000030206
AA Change: C353Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030206
Gene: ENSMUSG00000028483
AA Change: C353Y

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 198 401 6.5e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030207
SMART Domains Protein: ENSMUSP00000030207
Gene: ENSMUSG00000028484

DomainStartEndE-ValueType
PWWP 5 62 1.98e-17 SMART
low complexity region 143 155 N/A INTRINSIC
low complexity region 212 255 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 327 343 N/A INTRINSIC
Pfam:LEDGF 347 448 4.4e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123262
AA Change: C353Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124038
Gene: ENSMUSG00000028483
AA Change: C353Y

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 197 403 3.3e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124856
AA Change: C353Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124181
Gene: ENSMUSG00000028483
AA Change: C353Y

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 197 403 3.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137512
Predicted Effect probably damaging
Transcript: ENSMUST00000143533
AA Change: C353Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123793
Gene: ENSMUSG00000028483
AA Change: C353Y

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 197 403 3.3e-76 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 T C 5: 94,383,692 L145P probably damaging Het
AI661453 C A 17: 47,466,329 probably benign Het
Apc2 T G 10: 80,307,464 L466R probably damaging Het
Baz1b C A 5: 135,216,855 P386H probably damaging Het
Ccdc149 T C 5: 52,376,657 D389G probably benign Het
Cit T A 5: 115,945,903 probably null Het
Cmas C A 6: 142,756,870 A33E probably benign Het
Dcaf7 A G 11: 106,051,917 N230S probably damaging Het
Dcun1d5 C A 9: 7,206,837 probably benign Het
Dennd5b T A 6: 149,084,891 D58V probably benign Het
Dmrt2 C A 19: 25,678,467 Q477K probably damaging Het
Eva1c A G 16: 90,876,111 N90S probably damaging Het
Fcgbp A T 7: 28,105,010 I1848F possibly damaging Het
Fgfr2 T G 7: 130,167,804 M522L probably benign Het
Fshr C A 17: 88,986,367 K294N probably benign Het
Gja10 T C 4: 32,601,866 I173V probably benign Het
Gm7102 T C 19: 61,175,647 T117A probably damaging Het
Gmnn A G 13: 24,757,631 S32P probably damaging Het
Hdac9 T C 12: 34,437,181 N95D probably damaging Het
Ipo13 T C 4: 117,901,022 T715A probably damaging Het
Klrc2 A G 6: 129,658,824 S97P probably benign Het
Lrrn4 G A 2: 132,879,444 S151L probably benign Het
Man2a1 G T 17: 64,601,770 S12I possibly damaging Het
Mrgprb8 T A 7: 48,388,953 V124E possibly damaging Het
Myo5c T C 9: 75,272,846 W690R probably damaging Het
Ncapd2 T C 6: 125,173,782 K817E probably damaging Het
Olfr197 A G 16: 59,186,037 *149Q probably null Het
Olfr484 T A 7: 108,125,165 I33F probably benign Het
Olfr633 T C 7: 103,947,121 I185T probably damaging Het
Olfr914 T C 9: 38,606,936 M157T probably benign Het
Pcdh18 A T 3: 49,754,589 I759N probably damaging Het
Pcdhac2 A T 18: 37,145,154 N396Y probably damaging Het
Pcm1 T A 8: 41,313,400 C1542S probably benign Het
Pcsk1 T A 13: 75,126,002 V450E probably damaging Het
Pld2 A G 11: 70,554,295 K574E probably damaging Het
Psmc1 C T 12: 100,123,097 R410C probably benign Het
Rad51b C T 12: 79,327,250 S201L probably benign Het
Rgs3 T A 4: 62,626,496 L200Q probably damaging Het
Rims2 A G 15: 39,616,450 M1293V probably damaging Het
Scin C T 12: 40,081,020 G298D probably damaging Het
Scn8a C A 15: 100,969,133 F123L probably damaging Het
Sned1 C A 1: 93,283,256 S231* probably null Het
Tex15 A G 8: 33,577,546 T2335A probably benign Het
Tigd4 G A 3: 84,595,219 G481D probably benign Het
Trank1 T G 9: 111,390,275 F2027V probably benign Het
Ubr1 C T 2: 120,881,067 A1449T probably benign Het
Ulk1 G T 5: 110,799,136 Y89* probably null Het
Usp54 A G 14: 20,561,536 F1071L probably benign Het
Utrn C T 10: 12,711,446 E949K probably benign Het
Vmn2r65 T A 7: 84,940,756 T651S possibly damaging Het
Wdfy1 A G 1: 79,761,651 L17P probably damaging Het
Zfp672 G A 11: 58,329,855 probably benign Het
Other mutations in Snapc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Snapc3 APN 4 83436396 missense probably damaging 0.97
IGL01400:Snapc3 APN 4 83450177 missense probably damaging 1.00
IGL02031:Snapc3 APN 4 83417976 missense probably benign 0.04
IGL02475:Snapc3 APN 4 83450096 missense probably benign 0.04
IGL03141:Snapc3 APN 4 83435286 missense probably damaging 1.00
R0417:Snapc3 UTSW 4 83450162 missense probably benign 0.41
R0628:Snapc3 UTSW 4 83450160 missense probably benign 0.01
R0631:Snapc3 UTSW 4 83417802 missense probably damaging 0.99
R0647:Snapc3 UTSW 4 83450229 missense probably damaging 1.00
R2328:Snapc3 UTSW 4 83435277 nonsense probably null
R4454:Snapc3 UTSW 4 83418759 missense probably damaging 1.00
R4860:Snapc3 UTSW 4 83464897 intron probably benign
R6497:Snapc3 UTSW 4 83453126 nonsense probably null
R6762:Snapc3 UTSW 4 83435258 missense probably damaging 1.00
R7325:Snapc3 UTSW 4 83435270 missense probably benign 0.04
R7599:Snapc3 UTSW 4 83417836 nonsense probably null
R7880:Snapc3 UTSW 4 83435194 missense probably damaging 1.00
R9412:Snapc3 UTSW 4 83436333 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACAGGTCAGCCATGTTGC -3'
(R):5'- CCTGTATAACCTAGTGTGCATGTG -3'

Sequencing Primer
(F):5'- CAGGTCAGCCATGTTGCAGTAATG -3'
(R):5'- GCTCTGGGTTCAAGTCTGTACAAAAC -3'
Posted On 2021-01-18