Incidental Mutation 'R8489:Dcaf7'
ID657902
Institutional Source Beutler Lab
Gene Symbol Dcaf7
Ensembl Gene ENSMUSG00000049354
Gene NameDDB1 and CUL4 associated factor 7
Synonyms1700012F10Rik, 2610037L01Rik, Wdr68
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8489 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location106036872-106059324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106051917 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 230 (N230S)
Ref Sequence ENSEMBL: ENSMUSP00000058168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058438]
Predicted Effect probably damaging
Transcript: ENSMUST00000058438
AA Change: N230S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058168
Gene: ENSMUSG00000049354
AA Change: N230S

DomainStartEndE-ValueType
WD40 58 99 3.42e1 SMART
WD40 104 149 1.43e1 SMART
WD40 163 205 3.81e-5 SMART
WD40 211 251 1.1e2 SMART
WD40 255 295 8.88e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple WD40 repeats which facilitate protein-protein interactions and thereby enable the assembly of multiprotein complexes. This protein has been shown to function as a scaffold protein for protein complexes involved in kinase signaling. This highly conserved gene is present in eukaryotic plants, fungi, and animals. The ortholog of this gene was first identified in plants as a key regulator of anthocyanin biosynthesis and flower pigmentation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 T C 5: 94,383,692 L145P probably damaging Het
AI661453 C A 17: 47,466,329 probably benign Het
Apc2 T G 10: 80,307,464 L466R probably damaging Het
Baz1b C A 5: 135,216,855 P386H probably damaging Het
Ccdc149 T C 5: 52,376,657 D389G probably benign Het
Cit T A 5: 115,945,903 probably null Het
Cmas C A 6: 142,756,870 A33E probably benign Het
Dcun1d5 C A 9: 7,206,837 probably benign Het
Dennd5b T A 6: 149,084,891 D58V probably benign Het
Dmrt2 C A 19: 25,678,467 Q477K probably damaging Het
Eva1c A G 16: 90,876,111 N90S probably damaging Het
Fcgbp A T 7: 28,105,010 I1848F possibly damaging Het
Fgfr2 T G 7: 130,167,804 M522L probably benign Het
Fshr C A 17: 88,986,367 K294N probably benign Het
Gja10 T C 4: 32,601,866 I173V probably benign Het
Gm7102 T C 19: 61,175,647 T117A probably damaging Het
Gmnn A G 13: 24,757,631 S32P probably damaging Het
Hdac9 T C 12: 34,437,181 N95D probably damaging Het
Ipo13 T C 4: 117,901,022 T715A probably damaging Het
Klrc2 A G 6: 129,658,824 S97P probably benign Het
Lrrn4 G A 2: 132,879,444 S151L probably benign Het
Man2a1 G T 17: 64,601,770 S12I possibly damaging Het
Mrgprb8 T A 7: 48,388,953 V124E possibly damaging Het
Myo5c T C 9: 75,272,846 W690R probably damaging Het
Ncapd2 T C 6: 125,173,782 K817E probably damaging Het
Olfr197 A G 16: 59,186,037 *149Q probably null Het
Olfr484 T A 7: 108,125,165 I33F probably benign Het
Olfr633 T C 7: 103,947,121 I185T probably damaging Het
Olfr914 T C 9: 38,606,936 M157T probably benign Het
Pcdh18 A T 3: 49,754,589 I759N probably damaging Het
Pcdhac2 A T 18: 37,145,154 N396Y probably damaging Het
Pcm1 T A 8: 41,313,400 C1542S probably benign Het
Pcsk1 T A 13: 75,126,002 V450E probably damaging Het
Pld2 A G 11: 70,554,295 K574E probably damaging Het
Psmc1 C T 12: 100,123,097 R410C probably benign Het
Rad51b C T 12: 79,327,250 S201L probably benign Het
Rgs3 T A 4: 62,626,496 L200Q probably damaging Het
Rims2 A G 15: 39,616,450 M1293V probably damaging Het
Scin C T 12: 40,081,020 G298D probably damaging Het
Scn8a C A 15: 100,969,133 F123L probably damaging Het
Snapc3 G A 4: 83,451,294 C353Y probably damaging Het
Sned1 C A 1: 93,283,256 S231* probably null Het
Tex15 A G 8: 33,577,546 T2335A probably benign Het
Tigd4 G A 3: 84,595,219 G481D probably benign Het
Trank1 T G 9: 111,390,275 F2027V probably benign Het
Ubr1 C T 2: 120,881,067 A1449T probably benign Het
Ulk1 G T 5: 110,799,136 Y89* probably null Het
Usp54 A G 14: 20,561,536 F1071L probably benign Het
Utrn C T 10: 12,711,446 E949K probably benign Het
Vmn2r65 T A 7: 84,940,756 T651S possibly damaging Het
Wdfy1 A G 1: 79,761,651 L17P probably damaging Het
Zfp672 G A 11: 58,329,855 probably benign Het
Other mutations in Dcaf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Dcaf7 APN 11 106054746 missense probably damaging 1.00
IGL01584:Dcaf7 APN 11 106053827 missense probably benign 0.12
IGL02398:Dcaf7 APN 11 106053753 missense probably benign 0.03
IGL02516:Dcaf7 APN 11 106051872 missense probably damaging 1.00
IGL02672:Dcaf7 APN 11 106054858 utr 3 prime probably benign
IGL02892:Dcaf7 APN 11 106046692 missense possibly damaging 0.95
IGL02953:Dcaf7 APN 11 106051876 nonsense probably null
R0179:Dcaf7 UTSW 11 106051797 missense probably damaging 0.98
R0539:Dcaf7 UTSW 11 106051826 missense probably damaging 0.98
R1471:Dcaf7 UTSW 11 106046747 missense probably benign 0.01
R1647:Dcaf7 UTSW 11 106051802 missense probably damaging 1.00
R1648:Dcaf7 UTSW 11 106051802 missense probably damaging 1.00
R3551:Dcaf7 UTSW 11 106054796 missense probably benign 0.00
R4656:Dcaf7 UTSW 11 106053798 missense probably damaging 1.00
R6167:Dcaf7 UTSW 11 106037251 missense probably damaging 0.99
R6192:Dcaf7 UTSW 11 106051758 missense probably damaging 1.00
R6782:Dcaf7 UTSW 11 106054755 missense probably damaging 1.00
R6864:Dcaf7 UTSW 11 106046821 missense probably damaging 1.00
R7155:Dcaf7 UTSW 11 106037190 missense probably damaging 0.97
R7253:Dcaf7 UTSW 11 106047843 splice site probably null
R7446:Dcaf7 UTSW 11 106053735 missense probably benign 0.04
R7631:Dcaf7 UTSW 11 106053753 missense probably benign 0.03
R8109:Dcaf7 UTSW 11 106046778 missense probably damaging 0.98
R8480:Dcaf7 UTSW 11 106054793 missense probably benign 0.00
R8731:Dcaf7 UTSW 11 106054722 missense possibly damaging 0.93
Z1177:Dcaf7 UTSW 11 106053795 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCCAACAGGTCTATGACATC -3'
(R):5'- TGATGCCAGGAAGACTCCAC -3'

Sequencing Primer
(F):5'- ACAGGTCTATGACATCGCCTTCAG -3'
(R):5'- ACTACACACTCTAACTTTTGACAATC -3'
Posted On2021-01-18