Incidental Mutation 'R8540:Uhrf1'
ID 659388
Institutional Source Beutler Lab
Gene Symbol Uhrf1
Ensembl Gene ENSMUSG00000001228
Gene Name ubiquitin-like, containing PHD and RING finger domains, 1
Synonyms Np95, ICBP90
MMRRC Submission 068506-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8540 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 56610405-56630486 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 56612105 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 3 (I3N)
Ref Sequence ENSEMBL: ENSMUSP00000125830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001258] [ENSMUST00000097303] [ENSMUST00000113035] [ENSMUST00000113038] [ENSMUST00000113039] [ENSMUST00000142387]
AlphaFold Q8VDF2
Predicted Effect probably damaging
Transcript: ENSMUST00000001258
AA Change: I3N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001258
Gene: ENSMUSG00000001228
AA Change: I3N

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:DUF3590 136 232 1.1e-42 PFAM
PHD 322 369 6.39e-12 SMART
RING 323 368 1.09e0 SMART
low complexity region 381 398 N/A INTRINSIC
SRA 419 590 8.5e-113 SMART
low complexity region 635 653 N/A INTRINSIC
RING 713 751 8.43e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097303
SMART Domains Protein: ENSMUSP00000094906
Gene: ENSMUSG00000073380

DomainStartEndE-ValueType
Pfam:Arrestin_N 7 144 3.3e-21 PFAM
Arrestin_C 170 307 7.47e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113035
AA Change: I3N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108658
Gene: ENSMUSG00000001228
AA Change: I3N

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:DUF3590 136 232 1.1e-42 PFAM
PHD 314 361 6.39e-12 SMART
RING 315 360 1.09e0 SMART
low complexity region 373 390 N/A INTRINSIC
SRA 411 582 8.5e-113 SMART
low complexity region 627 645 N/A INTRINSIC
RING 705 743 8.43e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113038
AA Change: I3N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108661
Gene: ENSMUSG00000001228
AA Change: I3N

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:DUF3590 136 232 1.1e-42 PFAM
PHD 314 361 6.39e-12 SMART
RING 315 360 1.09e0 SMART
low complexity region 373 390 N/A INTRINSIC
SRA 411 582 8.5e-113 SMART
low complexity region 627 645 N/A INTRINSIC
RING 705 743 8.43e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113039
AA Change: I3N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108662
Gene: ENSMUSG00000001228
AA Change: I3N

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:TTD 128 281 8e-61 PFAM
PHD 322 369 6.39e-12 SMART
RING 323 368 1.09e0 SMART
low complexity region 381 398 N/A INTRINSIC
SRA 419 590 8.5e-113 SMART
low complexity region 635 653 N/A INTRINSIC
RING 713 751 8.43e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142387
AA Change: I3N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125830
Gene: ENSMUSG00000001228
AA Change: I3N

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Meta Mutation Damage Score 0.6714 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of RING-finger type E3 ubiquitin ligases. The protein binds to specific DNA sequences, and recruits a histone deacetylase to regulate gene expression. Its expression peaks at late G1 phase and continues during G2 and M phases of the cell cycle. It plays a major role in the G1/S transition by regulating topoisomerase IIalpha and retinoblastoma gene expression, and functions in the p53-dependent DNA damage checkpoint. It is regarded as a hub protein for the integration of epigenetic information. This gene is up-regulated in various cancers, and it is therefore considered to be a therapeutic target. Multiple transcript variants encoding different isoforms have been found for this gene. A related pseudogene exists on chromosome 12. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for disruption of this marker die early in gestation showing growth retardation and various malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 A T 6: 140,579,437 (GRCm39) I225L probably benign Het
Aebp2 A G 6: 140,579,439 (GRCm39) I225M probably benign Het
Ap2a1 C A 7: 44,553,750 (GRCm39) G566C probably damaging Het
Cdk15 T C 1: 59,349,992 (GRCm39) V328A possibly damaging Het
Cyld G A 8: 89,473,568 (GRCm39) G929D probably damaging Het
Ddx50 G A 10: 62,476,569 (GRCm39) L235F possibly damaging Het
Dlg5 T C 14: 24,208,767 (GRCm39) D813G probably damaging Het
Epb41l3 C T 17: 69,593,757 (GRCm39) T797M probably damaging Het
Foxred2 G A 15: 77,836,212 (GRCm39) R382W probably damaging Het
Gm5798 T A 14: 41,070,674 (GRCm39) I28N possibly damaging Het
Grb14 C T 2: 64,851,478 (GRCm39) V91M probably benign Het
Ints6 T C 14: 62,934,353 (GRCm39) D718G probably benign Het
Man2a1 C A 17: 64,965,982 (GRCm39) H307N probably benign Het
Mylk T C 16: 34,750,257 (GRCm39) Y1199H possibly damaging Het
Nim1k T C 13: 120,175,718 (GRCm39) S163G probably benign Het
Or1r1 A G 11: 73,875,153 (GRCm39) F94L probably damaging Het
Or51f5 G C 7: 102,424,339 (GRCm39) A203P possibly damaging Het
Or5ac16 A T 16: 59,022,323 (GRCm39) H155Q possibly damaging Het
Or8h6 C A 2: 86,703,776 (GRCm39) C97F probably damaging Het
Phyhip A G 14: 70,704,594 (GRCm39) D271G probably benign Het
Pramel27 T A 4: 143,579,496 (GRCm39) S360R probably benign Het
Pycr2 G A 1: 180,734,178 (GRCm39) A187T possibly damaging Het
Ryr3 T A 2: 112,630,367 (GRCm39) E2148V probably damaging Het
Septin12 T C 16: 4,805,481 (GRCm39) H304R probably damaging Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Ssx2ip T C 3: 146,124,114 (GRCm39) V43A probably benign Het
Syne2 A T 12: 76,141,148 (GRCm39) N6087Y probably damaging Het
Tbc1d4 A T 14: 101,845,712 (GRCm39) I62N probably damaging Het
Ttn C T 2: 76,573,337 (GRCm39) G24106D probably damaging Het
Urgcp A C 11: 5,667,915 (GRCm39) L141R probably damaging Het
Ush2a G A 1: 188,274,858 (GRCm39) R1777H probably benign Het
Vamp3 A G 4: 151,135,507 (GRCm39) V37A possibly damaging Het
Vmn1r172 C T 7: 23,359,498 (GRCm39) L128F possibly damaging Het
Vmn1r76 A G 7: 11,664,897 (GRCm39) Y71H probably damaging Het
Vmn2r111 C T 17: 22,778,023 (GRCm39) probably null Het
Vmn2r111 T A 17: 22,778,024 (GRCm39) N552Y probably damaging Het
Vmn2r81 A T 10: 79,129,065 (GRCm39) N652I probably damaging Het
Vmn2r87 T C 10: 130,314,762 (GRCm39) N275D possibly damaging Het
Wrn T A 8: 33,842,154 (GRCm39) I47F probably damaging Het
Other mutations in Uhrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00560:Uhrf1 APN 17 56,625,125 (GRCm39) missense probably damaging 1.00
IGL00925:Uhrf1 APN 17 56,627,535 (GRCm39) missense probably benign 0.00
IGL01432:Uhrf1 APN 17 56,625,250 (GRCm39) missense probably damaging 1.00
IGL02739:Uhrf1 APN 17 56,612,129 (GRCm39) missense probably benign 0.03
R0667:Uhrf1 UTSW 17 56,617,677 (GRCm39) missense probably benign 0.01
R0685:Uhrf1 UTSW 17 56,617,742 (GRCm39) missense probably damaging 0.99
R1121:Uhrf1 UTSW 17 56,619,917 (GRCm39) missense probably benign
R1462:Uhrf1 UTSW 17 56,625,035 (GRCm39) missense probably damaging 1.00
R1462:Uhrf1 UTSW 17 56,625,035 (GRCm39) missense probably damaging 1.00
R2088:Uhrf1 UTSW 17 56,625,089 (GRCm39) missense probably damaging 1.00
R2329:Uhrf1 UTSW 17 56,617,671 (GRCm39) splice site probably null
R2331:Uhrf1 UTSW 17 56,617,671 (GRCm39) splice site probably null
R2332:Uhrf1 UTSW 17 56,617,671 (GRCm39) splice site probably null
R3624:Uhrf1 UTSW 17 56,624,023 (GRCm39) missense probably damaging 1.00
R4065:Uhrf1 UTSW 17 56,625,020 (GRCm39) missense probably damaging 1.00
R4882:Uhrf1 UTSW 17 56,616,401 (GRCm39) missense probably damaging 1.00
R4901:Uhrf1 UTSW 17 56,617,834 (GRCm39) missense probably benign 0.01
R4913:Uhrf1 UTSW 17 56,622,478 (GRCm39) missense probably damaging 0.99
R5061:Uhrf1 UTSW 17 56,627,542 (GRCm39) splice site probably null
R5186:Uhrf1 UTSW 17 56,625,340 (GRCm39) missense probably damaging 1.00
R5711:Uhrf1 UTSW 17 56,627,259 (GRCm39) missense possibly damaging 0.49
R6917:Uhrf1 UTSW 17 56,616,574 (GRCm39) missense probably damaging 1.00
R7021:Uhrf1 UTSW 17 56,627,450 (GRCm39) missense probably benign 0.04
R7241:Uhrf1 UTSW 17 56,622,193 (GRCm39) missense probably damaging 1.00
R7692:Uhrf1 UTSW 17 56,619,905 (GRCm39) missense possibly damaging 0.91
R7875:Uhrf1 UTSW 17 56,619,884 (GRCm39) missense possibly damaging 0.46
R8731:Uhrf1 UTSW 17 56,629,363 (GRCm39) missense probably damaging 1.00
R8897:Uhrf1 UTSW 17 56,617,817 (GRCm39) missense probably damaging 1.00
R9349:Uhrf1 UTSW 17 56,617,737 (GRCm39) missense possibly damaging 0.95
R9681:Uhrf1 UTSW 17 56,625,083 (GRCm39) missense possibly damaging 0.51
R9708:Uhrf1 UTSW 17 56,629,357 (GRCm39) missense probably benign 0.01
R9723:Uhrf1 UTSW 17 56,625,061 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTACAGGAGATTGATCGTGG -3'
(R):5'- AACTGACTGGCGACTTGAGG -3'

Sequencing Primer
(F):5'- GGGAGTTGCTTCCTTTGCTCAATC -3'
(R):5'- CGCGGGCCTATTGCTTG -3'
Posted On 2021-01-18