Incidental Mutation 'R8547:Olfr382'
ID659699
Institutional Source Beutler Lab
Gene Symbol Olfr382
Ensembl Gene ENSMUSG00000095312
Gene Nameolfactory receptor 382
SynonymsMOR135-31_p, MOR135-14, GA_x6K02T2P1NL-3676608-3675670
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R8547 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location73516259-73517197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73516614 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 195 (N195S)
Ref Sequence ENSEMBL: ENSMUSP00000091575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092921]
Predicted Effect probably damaging
Transcript: ENSMUST00000092921
AA Change: N195S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091575
Gene: ENSMUSG00000095312
AA Change: N195S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.9e-10 PFAM
Pfam:7tm_1 41 290 1.2e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik A T 2: 23,230,123 Y177F probably damaging Het
Abca3 T C 17: 24,397,500 V972A probably benign Het
Adamts14 T G 10: 61,271,219 T41P probably damaging Het
Adamtsl3 C T 7: 82,428,413 T102I probably damaging Het
Ago3 T C 4: 126,370,316 I366V probably null Het
Aldh1a7 A G 19: 20,714,703 V242A possibly damaging Het
Asxl3 T C 18: 22,522,772 S1280P probably benign Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Caprin1 G T 2: 103,769,517 N604K probably damaging Het
Catsperb T C 12: 101,446,046 W131R probably damaging Het
Ccdc18 A G 5: 108,197,859 E957G probably damaging Het
Cd28 G A 1: 60,746,522 V17I probably benign Het
Cfl2 A T 12: 54,861,613 L75* probably null Het
Clspn T A 4: 126,561,816 L45H probably damaging Het
Col4a2 A G 8: 11,429,305 probably null Het
Dgka A T 10: 128,721,012 I663N probably damaging Het
Eppk1 C T 15: 76,109,049 V1211I probably benign Het
Fam193b A G 13: 55,550,304 S280P probably damaging Het
Fgd2 C T 17: 29,364,960 A116V probably damaging Het
Fmo5 C A 3: 97,651,495 Q424K probably benign Het
Fn3k T C 11: 121,450,161 L214P probably damaging Het
Gm3404 A T 5: 146,528,298 R283W possibly damaging Het
Gtdc1 A G 2: 44,788,981 probably benign Het
Hepacam T C 9: 37,367,753 I26T probably benign Het
Hltf T C 3: 20,098,127 F596L probably damaging Het
Ipo7 T G 7: 110,052,793 D926E probably benign Het
Krt16 G A 11: 100,246,257 Q463* probably null Het
Lats1 T C 10: 7,712,849 F1077L probably damaging Het
Lrrc69 T C 4: 14,704,014 I269V probably benign Het
Mcm6 C T 1: 128,345,948 E382K possibly damaging Het
Npbwr1 A T 1: 5,917,227 C23S possibly damaging Het
Nsd3 T C 8: 25,694,784 C962R probably damaging Het
Nufip2 T C 11: 77,692,565 L435P probably damaging Het
Olfr961 C T 9: 39,647,502 Q259* probably null Het
Psen1 T C 12: 83,714,856 V144A possibly damaging Het
Psmg2 T A 18: 67,646,007 S82T possibly damaging Het
Ptcd2 A C 13: 99,332,954 F154V probably damaging Het
Ptchd4 A C 17: 42,502,621 D471A probably benign Het
Robo4 C T 9: 37,404,378 T309I possibly damaging Het
Runx3 T C 4: 135,171,144 F209L probably damaging Het
Setd1a T C 7: 127,796,504 probably benign Het
Slc35g3 T C 11: 69,761,620 E22G probably benign Het
Spag9 T A 11: 94,122,821 M1303K possibly damaging Het
Ssh2 T A 11: 77,449,707 S562T probably benign Het
Tiparp T C 3: 65,546,377 probably null Het
Topbp1 C T 9: 103,336,065 P1028L probably benign Het
Unc45a A T 7: 80,326,092 L833Q possibly damaging Het
Vmn2r85 T C 10: 130,425,442 Y342C probably damaging Het
Vmn2r95 G A 17: 18,443,899 C460Y probably damaging Het
Vps13c T A 9: 67,945,566 I2376N probably damaging Het
Wisp3 T A 10: 39,151,198 D346V probably damaging Het
Zbtb21 C A 16: 97,952,115 A351S possibly damaging Het
Zzef1 T G 11: 72,844,441 Y623D probably damaging Het
Other mutations in Olfr382
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Olfr382 APN 11 73516410 missense possibly damaging 0.59
IGL00896:Olfr382 APN 11 73516341 missense probably damaging 1.00
IGL01723:Olfr382 APN 11 73516626 missense probably damaging 1.00
IGL01734:Olfr382 APN 11 73516636 missense probably benign 0.39
IGL02267:Olfr382 APN 11 73516549 missense probably benign 0.44
IGL02681:Olfr382 APN 11 73516530 missense probably benign
IGL03165:Olfr382 APN 11 73516884 nonsense probably null
BB009:Olfr382 UTSW 11 73517157 missense probably damaging 1.00
BB019:Olfr382 UTSW 11 73517157 missense probably damaging 1.00
IGL03134:Olfr382 UTSW 11 73517115 missense probably benign 0.02
R0320:Olfr382 UTSW 11 73516924 missense probably damaging 1.00
R0633:Olfr382 UTSW 11 73516927 missense probably benign 0.23
R0638:Olfr382 UTSW 11 73516924 missense probably damaging 1.00
R0691:Olfr382 UTSW 11 73516844 missense possibly damaging 0.55
R1630:Olfr382 UTSW 11 73516720 missense probably damaging 1.00
R2269:Olfr382 UTSW 11 73516483 missense probably damaging 1.00
R4001:Olfr382 UTSW 11 73516986 missense probably damaging 1.00
R4925:Olfr382 UTSW 11 73517172 missense possibly damaging 0.87
R5707:Olfr382 UTSW 11 73516625 missense probably damaging 1.00
R5911:Olfr382 UTSW 11 73516525 missense probably damaging 1.00
R6225:Olfr382 UTSW 11 73517005 missense probably damaging 0.99
R6251:Olfr382 UTSW 11 73516708 missense probably benign 0.00
R6332:Olfr382 UTSW 11 73517175 missense probably benign 0.00
R7013:Olfr382 UTSW 11 73516421 nonsense probably null
R7196:Olfr382 UTSW 11 73517131 missense probably benign
R7443:Olfr382 UTSW 11 73516848 missense possibly damaging 0.89
R7932:Olfr382 UTSW 11 73517157 missense probably damaging 1.00
R8201:Olfr382 UTSW 11 73517073 missense probably damaging 1.00
R8257:Olfr382 UTSW 11 73516377 missense probably benign 0.28
Z1177:Olfr382 UTSW 11 73517035 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCATGGAAATCTCCTTCACAG -3'
(R):5'- ATCATGAGCCCCACACTCTG -3'

Sequencing Primer
(F):5'- CATGGAAATCTCCTTCACAGTAGAG -3'
(R):5'- CACTCTGTGTGTGTCTGCTAG -3'
Posted On2021-01-18