Incidental Mutation 'R8550:Slc26a3'
ID659834
Institutional Source Beutler Lab
Gene Symbol Slc26a3
Ensembl Gene ENSMUSG00000001225
Gene Namesolute carrier family 26, member 3
Synonyms9030623B18Rik, 9130013M11Rik, Dra
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.717) question?
Stock #R8550 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location31390871-31473917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31461740 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 441 (L441F)
Ref Sequence ENSEMBL: ENSMUSP00000001254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001254] [ENSMUST00000171616]
Predicted Effect probably damaging
Transcript: ENSMUST00000001254
AA Change: L441F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001254
Gene: ENSMUSG00000001225
AA Change: L441F

DomainStartEndE-ValueType
Pfam:Sulfate_transp 73 468 3.1e-115 PFAM
low complexity region 475 481 N/A INTRINSIC
Pfam:STAS 519 709 2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171616
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: This gene encodes a member of the solute carrier/sulfate transporter family. The encoded protein is predominantly expressed in the intestine where it is essential for chloride absorption. Disruption of this gene results in chloride-rich diarrhea and compensatory up-regulation of ion-absorbing transporters. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygotes for a null allele display partial postnatal lethality; survivors are small and show lower luminal Cl-/HCO3- exchange activity, acidic chloridorrhea, volume depletion, upregulation of ion transporters, dilated colons, higher crypt proliferation and plasma aldosterone, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T C 19: 7,422,955 M262T probably benign Het
4930402F06Rik T A 2: 35,375,774 K295* probably null Het
9130409I23Rik A T 1: 181,059,759 D303V probably damaging Het
AB124611 A T 9: 21,540,586 D146V probably damaging Het
Adgrl3 A T 5: 81,794,752 T1469S possibly damaging Het
Anxa7 G A 14: 20,456,525 T449M probably damaging Het
Birc6 T G 17: 74,557,954 S236R probably benign Het
C1qc C T 4: 136,890,276 V170I possibly damaging Het
Ccl25 A G 8: 4,327,890 E50G possibly damaging Het
Clk1 A T 1: 58,412,676 Y427N probably damaging Het
Cul9 C A 17: 46,519,846 C1707F probably damaging Het
Cyp4f17 G A 17: 32,527,962 V413I probably benign Het
Ddc A G 11: 11,835,743 W315R probably damaging Het
Eogt A C 6: 97,112,072 H524Q probably benign Het
Eya4 G A 10: 23,106,258 H601Y probably damaging Het
Gm5039 T C 12: 88,323,882 probably benign Het
Hexa G A 9: 59,560,899 A270T probably benign Het
Hmcn2 T C 2: 31,350,642 probably null Het
Ighv5-17 A T 12: 113,859,284 S72R possibly damaging Het
Itgad A G 7: 128,203,892 T7A probably damaging Het
Mapk8 A T 14: 33,402,658 I139N probably damaging Het
Metap1 G A 3: 138,466,316 A280V possibly damaging Het
Mrpl35 T C 6: 71,816,275 K131E probably damaging Het
Neb A G 2: 52,298,912 V802A probably benign Het
Nlrp3 T G 11: 59,549,271 V558G probably damaging Het
Nr3c1 A T 18: 39,486,789 N148K possibly damaging Het
Olfr402 A C 11: 74,155,189 I12L probably benign Het
Padi6 T C 4: 140,732,703 K359R probably benign Het
Rexo5 A G 7: 119,801,345 T118A probably benign Het
Serpine1 A G 5: 137,063,498 V385A probably damaging Het
Slc25a25 A G 2: 32,416,193 I485T probably damaging Het
Spta1 A T 1: 174,187,208 D418V probably damaging Het
Supt20 T C 3: 54,715,642 V511A possibly damaging Het
Tfap2a T C 13: 40,728,749 T21A probably damaging Het
Tia1 A G 6: 86,425,702 M232V probably benign Het
Tmem132a T C 19: 10,860,381 T522A probably benign Het
Top2a A T 11: 98,995,918 D1336E probably benign Het
Trav3-1 A C 14: 52,580,933 R21S probably benign Het
Utrn C A 10: 12,813,585 probably benign Het
Vmn1r119 A T 7: 21,012,055 V134D probably benign Het
Other mutations in Slc26a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01446:Slc26a3 APN 12 31452491 splice site probably benign
IGL01717:Slc26a3 APN 12 31463477 missense probably benign 0.11
IGL02151:Slc26a3 APN 12 31447831 missense probably damaging 0.99
IGL02374:Slc26a3 APN 12 31470833 splice site probably benign
IGL02445:Slc26a3 APN 12 31457052 missense possibly damaging 0.65
IGL02526:Slc26a3 APN 12 31457096 missense probably damaging 1.00
IGL02831:Slc26a3 APN 12 31452629 missense probably damaging 1.00
PIT4486001:Slc26a3 UTSW 12 31470950 missense probably benign 0.01
R0422:Slc26a3 UTSW 12 31465849 missense possibly damaging 0.90
R0544:Slc26a3 UTSW 12 31447740 missense probably benign
R0781:Slc26a3 UTSW 12 31465813 missense possibly damaging 0.90
R1561:Slc26a3 UTSW 12 31466452 missense probably benign 0.18
R1860:Slc26a3 UTSW 12 31465846 missense probably benign
R1954:Slc26a3 UTSW 12 31450816 missense probably damaging 0.98
R1967:Slc26a3 UTSW 12 31465778 missense probably damaging 0.99
R2240:Slc26a3 UTSW 12 31457072 missense probably damaging 1.00
R2508:Slc26a3 UTSW 12 31470903 missense probably damaging 0.99
R3894:Slc26a3 UTSW 12 31464720 missense probably damaging 1.00
R3914:Slc26a3 UTSW 12 31453906 missense probably benign 0.00
R3978:Slc26a3 UTSW 12 31465860 splice site probably null
R4701:Slc26a3 UTSW 12 31447774 missense probably damaging 1.00
R4713:Slc26a3 UTSW 12 31457080 missense possibly damaging 0.75
R5024:Slc26a3 UTSW 12 31453908 missense probably benign
R5058:Slc26a3 UTSW 12 31470965 missense possibly damaging 0.66
R5168:Slc26a3 UTSW 12 31468554 missense possibly damaging 0.81
R5361:Slc26a3 UTSW 12 31450981 critical splice donor site probably null
R5715:Slc26a3 UTSW 12 31448843 critical splice donor site probably null
R5951:Slc26a3 UTSW 12 31452715 intron probably benign
R6662:Slc26a3 UTSW 12 31457346 nonsense probably null
R6895:Slc26a3 UTSW 12 31463524 missense probably damaging 0.96
R7069:Slc26a3 UTSW 12 31450935 missense probably damaging 0.96
R7484:Slc26a3 UTSW 12 31447788 missense probably benign 0.22
R7744:Slc26a3 UTSW 12 31463465 critical splice acceptor site probably null
R8192:Slc26a3 UTSW 12 31468542 missense probably benign 0.05
R8327:Slc26a3 UTSW 12 31466431 missense possibly damaging 0.81
R8356:Slc26a3 UTSW 12 31466506 missense probably benign 0.06
R8371:Slc26a3 UTSW 12 31452542 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGCACACCAGAAAAGGG -3'
(R):5'- TTCCAGGTAATGATCAGTAGAGC -3'

Sequencing Primer
(F):5'- AAAGGGCGAGTCCTTCCATACG -3'
(R):5'- TACAGTTATCACAAACAGCGAGG -3'
Posted On2021-01-18