Incidental Mutation 'R8351:Pygm'
ID660512
Institutional Source Beutler Lab
Gene Symbol Pygm
Ensembl Gene ENSMUSG00000032648
Gene Namemuscle glycogen phosphorylase
SynonymsPG
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8351 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6384399-6398459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6388087 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 141 (T141A)
Ref Sequence ENSEMBL: ENSMUSP00000109111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035269] [ENSMUST00000113483]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035269
AA Change: T229A

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047564
Gene: ENSMUSG00000032648
AA Change: T229A

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113483
AA Change: T141A

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109111
Gene: ENSMUSG00000032648
AA Change: T141A

DomainStartEndE-ValueType
Pfam:Phosphorylase 62 742 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: This gene encodes a glycolysis enzyme found in muscle. Highly similar enzymes encoded by different genes are found in liver and brain. The encoded protein is involved in regulating the breakdown of glycogen to glucose-1-phosphate, which is necessary for ATP generation. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null mutation exhibit massive muscle glycogen accumulation, elevated creatine kinase levels in blood, and very poor exercise performance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A C 6: 96,165,674 S130A probably benign Het
Agpat3 A T 10: 78,274,252 Y288N probably damaging Het
Ano5 A G 7: 51,553,878 K225E probably benign Het
Apob A G 12: 8,006,356 T1613A probably benign Het
Ascc3 A G 10: 50,849,597 T2139A probably benign Het
Asnsd1 A T 1: 53,347,013 probably null Het
Atp23 C T 10: 126,887,538 A232T probably damaging Het
Cd8b1 G A 6: 71,329,793 probably null Het
Cep295 G A 9: 15,322,906 T2198I probably damaging Het
Col12a1 G T 9: 79,681,412 N1140K probably damaging Het
Cyp2f2 A G 7: 27,121,869 Y69C probably damaging Het
Ep400 C T 5: 110,739,334 A628T probably damaging Het
Faxc A T 4: 21,932,046 probably null Het
Fpr3 T C 17: 17,971,174 S236P probably benign Het
Fsip2 T C 2: 82,991,895 S5991P possibly damaging Het
Gm3099 A T 14: 3,999,379 N58Y probably damaging Het
Gmps T C 3: 63,980,194 V29A probably benign Het
Gnptab T G 10: 88,414,486 D153E probably benign Het
Kcnh6 A G 11: 106,020,236 H486R probably damaging Het
Lama3 T C 18: 12,540,613 Y2571H probably damaging Het
Lama5 C T 2: 180,195,608 V995M probably damaging Het
Lrrc43 A G 5: 123,494,265 N157S probably damaging Het
Mbtps1 G A 8: 119,546,184 S74L probably benign Het
Muc16 A T 9: 18,659,885 V446D unknown Het
Ncapg2 T C 12: 116,440,027 V853A possibly damaging Het
Nkx2-6 T C 14: 69,172,027 S76P probably benign Het
Nuak1 T C 10: 84,394,117 I131V probably damaging Het
Oas1e A T 5: 120,786,943 probably null Het
Olfr354 T C 2: 36,907,137 F64L probably benign Het
Pde5a T C 3: 122,748,479 probably null Het
Plin4 T C 17: 56,106,861 T255A probably benign Het
Rps2 T A 17: 24,720,360 probably benign Het
Rptor A G 11: 119,892,639 D1153G probably benign Het
Ryr2 A G 13: 11,799,832 F685L probably damaging Het
Slc22a17 A G 14: 54,908,594 I356T probably benign Het
Slc29a4 T G 5: 142,717,829 I286S probably benign Het
Swap70 T C 7: 110,221,898 S30P possibly damaging Het
Tbc1d10c A G 19: 4,184,745 F439S probably damaging Het
Tbx3 T A 5: 119,680,776 L472Q probably damaging Het
Tbxas1 A G 6: 39,027,916 R366G possibly damaging Het
Ttll8 T C 15: 88,914,435 D699G probably benign Het
Vmn1r128 A T 7: 21,349,672 R100S probably damaging Het
Wdpcp A G 11: 21,748,931 D570G probably damaging Het
Znfx1 A G 2: 167,055,655 S450P probably damaging Het
Other mutations in Pygm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Pygm APN 19 6391394 missense probably benign
IGL01743:Pygm APN 19 6392994 splice site probably null
IGL01827:Pygm APN 19 6390377 missense probably damaging 1.00
IGL02032:Pygm APN 19 6388087 missense probably benign 0.23
IGL02261:Pygm APN 19 6388271 missense probably damaging 1.00
IGL02431:Pygm APN 19 6388118 missense probably damaging 1.00
IGL02511:Pygm APN 19 6385688 missense probably benign 0.22
IGL02967:Pygm APN 19 6393838 missense probably damaging 1.00
IGL03081:Pygm APN 19 6388821 missense possibly damaging 0.53
R0336:Pygm UTSW 19 6388758 missense probably damaging 1.00
R0415:Pygm UTSW 19 6391366 missense probably benign 0.06
R0799:Pygm UTSW 19 6386018 intron probably benign
R1445:Pygm UTSW 19 6389887 missense probably benign 0.20
R1752:Pygm UTSW 19 6391034 missense probably damaging 0.99
R1828:Pygm UTSW 19 6397607 missense possibly damaging 0.72
R2054:Pygm UTSW 19 6388155 missense probably benign 0.02
R2086:Pygm UTSW 19 6391481 critical splice donor site probably null
R2116:Pygm UTSW 19 6386408 missense probably damaging 0.98
R2431:Pygm UTSW 19 6393785 missense probably damaging 1.00
R2516:Pygm UTSW 19 6397601 missense probably benign 0.20
R3938:Pygm UTSW 19 6392950 missense probably benign 0.42
R4609:Pygm UTSW 19 6391409 missense possibly damaging 0.92
R4924:Pygm UTSW 19 6393724 missense probably damaging 1.00
R4995:Pygm UTSW 19 6398139 missense probably damaging 1.00
R5225:Pygm UTSW 19 6389464 missense probably benign 0.01
R5296:Pygm UTSW 19 6384579 missense probably damaging 1.00
R5437:Pygm UTSW 19 6390382 missense probably damaging 1.00
R5994:Pygm UTSW 19 6398043 critical splice acceptor site probably null
R6030:Pygm UTSW 19 6388812 missense possibly damaging 0.78
R6030:Pygm UTSW 19 6388812 missense possibly damaging 0.78
R6188:Pygm UTSW 19 6397937 splice site probably null
R6266:Pygm UTSW 19 6398139 missense probably damaging 1.00
R6799:Pygm UTSW 19 6398127 missense probably damaging 1.00
R6855:Pygm UTSW 19 6393757 missense probably damaging 1.00
R6856:Pygm UTSW 19 6393757 missense probably damaging 1.00
R6857:Pygm UTSW 19 6393757 missense probably damaging 1.00
R7223:Pygm UTSW 19 6388863 missense probably benign
R7256:Pygm UTSW 19 6385896 missense probably benign 0.01
R7263:Pygm UTSW 19 6388327 missense probably damaging 1.00
R7398:Pygm UTSW 19 6385936 missense probably damaging 1.00
R8093:Pygm UTSW 19 6386042 missense probably damaging 1.00
R8499:Pygm UTSW 19 6390362 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAACTGTAGTCTCTCTTGGGC -3'
(R):5'- ATGTTCTCGGCCAGGTTTC -3'

Sequencing Primer
(F):5'- CACTGGCAGAGTTCAGTGAC -3'
(R):5'- GATGTAGCCGCCAACATTGACTG -3'
Posted On2021-01-18