Incidental Mutation 'R8750:Mfrp'
ID663784
Institutional Source Beutler Lab
Gene Symbol Mfrp
Ensembl Gene ENSMUSG00000034739
Gene Namemembrane frizzled-related protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R8750 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location44101729-44109187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44103505 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 280 (K280E)
Ref Sequence ENSEMBL: ENSMUSP00000034654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034654] [ENSMUST00000065379] [ENSMUST00000114815] [ENSMUST00000114816] [ENSMUST00000114818] [ENSMUST00000114821] [ENSMUST00000152956] [ENSMUST00000161381] [ENSMUST00000161703] [ENSMUST00000162126] [ENSMUST00000185479] [ENSMUST00000205282] [ENSMUST00000205500] [ENSMUST00000206295] [ENSMUST00000206308] [ENSMUST00000206769]
Predicted Effect probably benign
Transcript: ENSMUST00000034654
AA Change: K280E

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000034654
Gene: ENSMUSG00000034739
AA Change: K280E

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
CUB 150 259 3.6e-35 SMART
LDLa 265 302 1.5e-8 SMART
CUB 307 420 1.85e-37 SMART
Pfam:Fz 471 577 3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065379
SMART Domains Protein: ENSMUSP00000070060
Gene: ENSMUSG00000053128

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114815
SMART Domains Protein: ENSMUSP00000110463
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 235 2.09e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114816
SMART Domains Protein: ENSMUSP00000110464
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 235 2.09e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114818
SMART Domains Protein: ENSMUSP00000110466
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 235 2.09e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114821
SMART Domains Protein: ENSMUSP00000110469
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 220 1.01e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152956
SMART Domains Protein: ENSMUSP00000123040
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:Collagen 28 102 7.2e-10 PFAM
Pfam:C1q 105 138 1.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160985
SMART Domains Protein: ENSMUSP00000124568
Gene: ENSMUSG00000053128

DomainStartEndE-ValueType
RING 11 52 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161381
AA Change: K280E

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124456
Gene: ENSMUSG00000034739
AA Change: K280E

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
CUB 150 259 3.6e-35 SMART
LDLa 265 302 1.5e-8 SMART
CUB 307 420 1.85e-37 SMART
Pfam:Fz 465 576 9.1e-22 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000125053
Gene: ENSMUSG00000034739
AA Change: K280E

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
CUB 150 259 3.6e-35 SMART
LDLa 265 302 1.5e-8 SMART
LDLa 307 342 2.09e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162126
SMART Domains Protein: ENSMUSP00000123938
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185479
SMART Domains Protein: ENSMUSP00000140405
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205282
Predicted Effect probably benign
Transcript: ENSMUST00000205500
Predicted Effect probably benign
Transcript: ENSMUST00000206295
Predicted Effect probably benign
Transcript: ENSMUST00000206308
AA Change: K280E

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000206722
Predicted Effect probably benign
Transcript: ENSMUST00000206769
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene contains a region with similarity to the cysteine-rich domain (CRD) of frizzled, a gene originally found in Drosophila that controls tissue polarity. This protein functions in eye development, where it is necessary for the maintenance of photoreceptor outer segments. Mutations in this gene cause retinal degeneration 6 in mice, which gives rise to a mouse model for human retinitis punctata albescens. Bicistronic transcripts composed of the coding sequences for this gene (Mfrp) and the C1q and tumor necrosis factor related protein 5 gene (C1qtnf5) have been identified, and the resulting products can interact with each other. Co-transcription of C1qtnf5 and Mfrp has been observed in both human and mouse. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mutations produce mice having small, white retinal spots and progressive photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 G A 12: 81,560,473 Q172* probably null Het
Ankib1 A G 5: 3,702,890 probably null Het
Avpr1b C T 1: 131,599,936 R66C probably damaging Het
Bbs7 A T 3: 36,607,595 C152S possibly damaging Het
Cacna1a C A 8: 84,559,155 R810S probably damaging Het
Ccdc17 G A 4: 116,599,932 A538T possibly damaging Het
Cd93 T C 2: 148,443,160 M89V probably benign Het
Clec11a G T 7: 44,305,899 D157E probably benign Het
Crtam A C 9: 40,984,345 D228E probably benign Het
Cyp2a4 A G 7: 26,312,784 I331V probably benign Het
Cysltr2 T C 14: 73,029,638 I211V probably benign Het
Dcaf13 T C 15: 39,119,441 S123P probably damaging Het
Dctn1 T G 6: 83,183,126 V116G possibly damaging Het
Dmrt3 G A 19: 25,611,186 A130T probably benign Het
Dnah1 A T 14: 31,304,967 L700Q probably benign Het
Dnajc1 T C 2: 18,308,834 T159A probably damaging Het
Dpyd C T 3: 119,141,936 S670L probably damaging Het
Dsg2 A T 18: 20,575,012 I57F possibly damaging Het
Dzip3 A C 16: 48,980,975 I62S probably damaging Het
Ern1 A T 11: 106,421,950 S202T probably damaging Het
Foxm1 T A 6: 128,373,243 C517* probably null Het
Galnt16 G A 12: 80,598,105 V501I probably benign Het
Gmip A T 8: 69,820,484 R840S probably benign Het
Gna14 A C 19: 16,608,094 I279L Het
Irak2 T C 6: 113,686,822 M444T probably benign Het
Itfg2 T C 6: 128,412,792 probably null Het
Kif5a T A 10: 127,248,040 H94L probably damaging Het
Kmt2e A G 5: 23,493,217 T636A probably benign Het
Krba1 T C 6: 48,405,278 S152P probably damaging Het
Mad1l1 T A 5: 140,315,067 M25L probably benign Het
Map7d1 T C 4: 126,238,522 N286D probably benign Het
Mlh3 G T 12: 85,261,714 L1100I probably damaging Het
Mrgprx2 T C 7: 48,482,030 I347V probably benign Het
Mtnr1b A T 9: 15,874,428 C11* probably null Het
Mx1 T C 16: 97,451,717 E401G probably damaging Het
Mypn T C 10: 63,167,257 D367G probably benign Het
Olfr1013 T A 2: 85,769,963 L54H probably damaging Het
Olfr281 T G 15: 98,457,048 I246R probably damaging Het
Olfr622 T A 7: 103,639,852 D96V probably damaging Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Plcb1 T G 2: 135,335,449 M567R probably damaging Het
Plekhd1 A T 12: 80,706,087 D109V probably damaging Het
Polr2e A G 10: 80,039,590 I17T probably benign Het
Pot1b T C 17: 55,666,537 D421G probably benign Het
Prkar1b A T 5: 139,050,696 W224R probably damaging Het
Psmd1 C A 1: 86,088,863 R490S probably damaging Het
Pwp2 A G 10: 78,177,825 W521R probably damaging Het
Rhpn2 C A 7: 35,376,255 Q286K probably benign Het
Rnf103 T A 6: 71,509,618 M411K probably benign Het
Scpep1 A C 11: 88,944,472 V125G probably damaging Het
Serpinb9c C T 13: 33,151,810 V248M probably null Het
Slc9a3r2 T C 17: 24,642,259 I176V probably damaging Het
Snx15 T A 19: 6,120,563 N282I probably benign Het
Spaca3 A T 11: 80,867,688 D159V probably benign Het
Srrm4 A G 5: 116,467,508 V230A unknown Het
Ssu2 T A 6: 112,382,351 I103F possibly damaging Het
Strip2 T A 6: 29,931,816 F453I probably damaging Het
Tac2 C T 10: 127,728,450 P72L possibly damaging Het
Tiparp T G 3: 65,552,704 S473R probably damaging Het
Tmem135 C T 7: 89,307,248 R53Q probably damaging Het
Tmem200b T A 4: 131,922,095 F109I probably damaging Het
Tmem245 A T 4: 56,886,141 I825N probably damaging Het
Tmem63c G T 12: 87,056,532 V27F probably damaging Het
Tshz1 T C 18: 84,015,037 I415M probably damaging Het
Wfdc2 T A 2: 164,565,898 N162K probably damaging Het
Zcchc11 C G 4: 108,550,743 A1403G probably damaging Het
Zeb2 T A 2: 44,997,927 I373F probably damaging Het
Zfp27 T C 7: 29,895,379 N387S possibly damaging Het
Zfp760 A T 17: 21,722,375 H177L possibly damaging Het
Zg16 A G 7: 127,050,346 S148P possibly damaging Het
Zic2 A G 14: 122,476,717 N348D probably benign Het
Zswim4 A T 8: 84,212,684 D856E possibly damaging Het
Other mutations in Mfrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02070:Mfrp APN 9 44104689 missense probably benign 0.39
IGL02077:Mfrp APN 9 44105220 missense probably damaging 1.00
IGL02313:Mfrp APN 9 44102874 missense probably damaging 1.00
IGL02544:Mfrp APN 9 44102794 missense probably damaging 1.00
IGL02709:Mfrp APN 9 44103264 missense probably benign 0.00
R1592:Mfrp UTSW 9 44103222 missense probably damaging 1.00
R1728:Mfrp UTSW 9 44104587 missense possibly damaging 0.73
R1729:Mfrp UTSW 9 44104587 missense possibly damaging 0.73
R1886:Mfrp UTSW 9 44103488 missense possibly damaging 0.94
R1974:Mfrp UTSW 9 44106372 missense probably damaging 1.00
R2146:Mfrp UTSW 9 44103718 missense probably benign 0.12
R2150:Mfrp UTSW 9 44103718 missense probably benign 0.12
R2512:Mfrp UTSW 9 44102538 missense probably benign 0.01
R3788:Mfrp UTSW 9 44105457 nonsense probably null
R4204:Mfrp UTSW 9 44105228 missense possibly damaging 0.86
R4240:Mfrp UTSW 9 44102866 missense possibly damaging 0.91
R4839:Mfrp UTSW 9 44102135 missense possibly damaging 0.89
R4963:Mfrp UTSW 9 44103264 missense probably benign 0.33
R5041:Mfrp UTSW 9 44102278 missense probably damaging 1.00
R6370:Mfrp UTSW 9 44106261 missense probably damaging 1.00
R7420:Mfrp UTSW 9 44102476 unclassified probably benign
R7454:Mfrp UTSW 9 44105183 missense possibly damaging 0.90
R8850:Mfrp UTSW 9 44102510 missense probably benign 0.10
Z1177:Mfrp UTSW 9 44102519 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCCCTGGACATTGTAAGTG -3'
(R):5'- TAGTTTGGGGTAGAGAATACGC -3'

Sequencing Primer
(F):5'- TGGACATTGTAAGTGACTTCCC -3'
(R):5'- ATAGAGCCCAGTCAGGTTCC -3'
Posted On2021-03-08