Incidental Mutation 'R8750:Ankib1'
ID 663758
Institutional Source Beutler Lab
Gene Symbol Ankib1
Ensembl Gene ENSMUSG00000040351
Gene Name ankyrin repeat and IBR domain containing 1
Synonyms 2310061P20Rik, 4631416I11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8750 (G1)
Quality Score 199.009
Status Not validated
Chromosome 5
Chromosomal Location 3690000-3802925 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 3702890 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043551] [ENSMUST00000200335]
AlphaFold Q6ZPS6
Predicted Effect probably null
Transcript: ENSMUST00000043551
SMART Domains Protein: ENSMUSP00000040946
Gene: ENSMUSG00000040351

DomainStartEndE-ValueType
ANK 45 75 7.08e-1 SMART
ANK 145 174 2.32e-5 SMART
low complexity region 209 219 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
RING 334 382 9.73e-2 SMART
IBR 403 479 8.72e-12 SMART
IBR 502 566 2.59e-5 SMART
RING 520 644 2.36e0 SMART
low complexity region 764 773 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
UIM 846 865 3.62e-1 SMART
low complexity region 905 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200335
SMART Domains Protein: ENSMUSP00000142687
Gene: ENSMUSG00000040351

DomainStartEndE-ValueType
ANK 45 75 4.5e-3 SMART
ANK 145 174 1.4e-7 SMART
low complexity region 209 219 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
RING 334 382 4.6e-4 SMART
IBR 403 479 2.9e-14 SMART
IBR 502 566 8.3e-8 SMART
RING 520 644 1.1e-2 SMART
low complexity region 768 779 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 G A 12: 81,560,473 Q172* probably null Het
Avpr1b C T 1: 131,599,936 R66C probably damaging Het
Bbs7 A T 3: 36,607,595 C152S possibly damaging Het
Cacna1a C A 8: 84,559,155 R810S probably damaging Het
Ccdc17 G A 4: 116,599,932 A538T possibly damaging Het
Cd93 T C 2: 148,443,160 M89V probably benign Het
Clec11a G T 7: 44,305,899 D157E probably benign Het
Crtam A C 9: 40,984,345 D228E probably benign Het
Cyp2a4 A G 7: 26,312,784 I331V probably benign Het
Cysltr2 T C 14: 73,029,638 I211V probably benign Het
Dcaf13 T C 15: 39,119,441 S123P probably damaging Het
Dctn1 T G 6: 83,183,126 V116G possibly damaging Het
Dmrt3 G A 19: 25,611,186 A130T probably benign Het
Dnah1 A T 14: 31,304,967 L700Q probably benign Het
Dnajc1 T C 2: 18,308,834 T159A probably damaging Het
Dpyd C T 3: 119,141,936 S670L probably damaging Het
Dsg2 A T 18: 20,575,012 I57F possibly damaging Het
Dzip3 A C 16: 48,980,975 I62S probably damaging Het
Ern1 A T 11: 106,421,950 S202T probably damaging Het
Foxm1 T A 6: 128,373,243 C517* probably null Het
Galnt16 G A 12: 80,598,105 V501I probably benign Het
Gmip A T 8: 69,820,484 R840S probably benign Het
Gna14 A C 19: 16,608,094 I279L Het
Irak2 T C 6: 113,686,822 M444T probably benign Het
Itfg2 T C 6: 128,412,792 probably null Het
Kif5a T A 10: 127,248,040 H94L probably damaging Het
Kmt2e A G 5: 23,493,217 T636A probably benign Het
Krba1 T C 6: 48,405,278 S152P probably damaging Het
Mad1l1 T A 5: 140,315,067 M25L probably benign Het
Map7d1 T C 4: 126,238,522 N286D probably benign Het
Mfrp A G 9: 44,103,505 K280E probably benign Het
Mlh3 G T 12: 85,261,714 L1100I probably damaging Het
Mrgprx2 T C 7: 48,482,030 I347V probably benign Het
Mtnr1b A T 9: 15,874,428 C11* probably null Het
Mx1 T C 16: 97,451,717 E401G probably damaging Het
Mypn T C 10: 63,167,257 D367G probably benign Het
Olfr1013 T A 2: 85,769,963 L54H probably damaging Het
Olfr281 T G 15: 98,457,048 I246R probably damaging Het
Olfr622 T A 7: 103,639,852 D96V probably damaging Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Plcb1 T G 2: 135,335,449 M567R probably damaging Het
Plekhd1 A T 12: 80,706,087 D109V probably damaging Het
Polr2e A G 10: 80,039,590 I17T probably benign Het
Pot1b T C 17: 55,666,537 D421G probably benign Het
Prkar1b A T 5: 139,050,696 W224R probably damaging Het
Psmd1 C A 1: 86,088,863 R490S probably damaging Het
Pwp2 A G 10: 78,177,825 W521R probably damaging Het
Rhpn2 C A 7: 35,376,255 Q286K probably benign Het
Rnf103 T A 6: 71,509,618 M411K probably benign Het
Scpep1 A C 11: 88,944,472 V125G probably damaging Het
Serpinb9c C T 13: 33,151,810 V248M probably null Het
Slc9a3r2 T C 17: 24,642,259 I176V probably damaging Het
Snx15 T A 19: 6,120,563 N282I probably benign Het
Spaca3 A T 11: 80,867,688 D159V probably benign Het
Srrm4 A G 5: 116,467,508 V230A unknown Het
Ssu2 T A 6: 112,382,351 I103F possibly damaging Het
Strip2 T A 6: 29,931,816 F453I probably damaging Het
Tac2 C T 10: 127,728,450 P72L possibly damaging Het
Tiparp T G 3: 65,552,704 S473R probably damaging Het
Tmem135 C T 7: 89,307,248 R53Q probably damaging Het
Tmem200b T A 4: 131,922,095 F109I probably damaging Het
Tmem245 A T 4: 56,886,141 I825N probably damaging Het
Tmem63c G T 12: 87,056,532 V27F probably damaging Het
Tshz1 T C 18: 84,015,037 I415M probably damaging Het
Wfdc2 T A 2: 164,565,898 N162K probably damaging Het
Zcchc11 C G 4: 108,550,743 A1403G probably damaging Het
Zeb2 T A 2: 44,997,927 I373F probably damaging Het
Zfp27 T C 7: 29,895,379 N387S possibly damaging Het
Zfp760 A T 17: 21,722,375 H177L possibly damaging Het
Zg16 A G 7: 127,050,346 S148P possibly damaging Het
Zic2 A G 14: 122,476,717 N348D probably benign Het
Zswim4 A T 8: 84,212,684 D856E possibly damaging Het
Other mutations in Ankib1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Ankib1 APN 5 3727573 missense probably benign 0.20
IGL01329:Ankib1 APN 5 3734194 splice site probably benign
IGL01372:Ankib1 APN 5 3772594 missense probably damaging 1.00
IGL01593:Ankib1 APN 5 3732590 missense probably benign 0.00
IGL01613:Ankib1 APN 5 3713146 nonsense probably null
IGL01728:Ankib1 APN 5 3701992 splice site probably benign
IGL01782:Ankib1 APN 5 3727607 missense probably damaging 1.00
IGL01878:Ankib1 APN 5 3734152 missense possibly damaging 0.69
IGL02730:Ankib1 APN 5 3702995 missense probably damaging 1.00
IGL02742:Ankib1 APN 5 3693479 missense probably benign 0.04
IGL02873:Ankib1 APN 5 3772619 missense probably damaging 1.00
R0033:Ankib1 UTSW 5 3769588 missense possibly damaging 0.52
R0242:Ankib1 UTSW 5 3700344 splice site probably benign
R0564:Ankib1 UTSW 5 3729655 missense probably damaging 0.99
R0632:Ankib1 UTSW 5 3772529 missense probably benign 0.02
R0732:Ankib1 UTSW 5 3713163 missense possibly damaging 0.89
R1678:Ankib1 UTSW 5 3706301 missense probably damaging 0.99
R1816:Ankib1 UTSW 5 3734028 missense probably benign 0.05
R2165:Ankib1 UTSW 5 3713210 missense possibly damaging 0.69
R3434:Ankib1 UTSW 5 3692760 missense probably damaging 1.00
R3749:Ankib1 UTSW 5 3734097 missense probably damaging 0.98
R4745:Ankib1 UTSW 5 3732566 missense probably damaging 1.00
R4827:Ankib1 UTSW 5 3701907 missense probably damaging 1.00
R4983:Ankib1 UTSW 5 3769652 missense probably benign 0.09
R4989:Ankib1 UTSW 5 3713217 missense probably damaging 0.99
R5022:Ankib1 UTSW 5 3734011 missense possibly damaging 0.96
R5057:Ankib1 UTSW 5 3734011 missense possibly damaging 0.96
R5510:Ankib1 UTSW 5 3729693 missense probably benign 0.02
R5606:Ankib1 UTSW 5 3701907 missense probably damaging 1.00
R5910:Ankib1 UTSW 5 3693217 missense probably benign
R5929:Ankib1 UTSW 5 3769633 missense possibly damaging 0.86
R5986:Ankib1 UTSW 5 3747071 missense probably damaging 1.00
R6281:Ankib1 UTSW 5 3701965 missense possibly damaging 0.70
R6336:Ankib1 UTSW 5 3700377 nonsense probably null
R6377:Ankib1 UTSW 5 3693855 missense possibly damaging 0.78
R7001:Ankib1 UTSW 5 3694781 missense probably benign
R7264:Ankib1 UTSW 5 3755739 missense probably damaging 1.00
R7380:Ankib1 UTSW 5 3722576 missense probably benign 0.03
R7402:Ankib1 UTSW 5 3769586 missense probably benign 0.01
R7491:Ankib1 UTSW 5 3701911 missense probably damaging 1.00
R7525:Ankib1 UTSW 5 3755734 missense possibly damaging 0.95
R7562:Ankib1 UTSW 5 3747021 missense probably null 1.00
R8116:Ankib1 UTSW 5 3702995 missense probably damaging 1.00
R8347:Ankib1 UTSW 5 3747065 missense probably damaging 1.00
R8712:Ankib1 UTSW 5 3772643 missense probably benign 0.03
R8854:Ankib1 UTSW 5 3727489 missense probably null 0.97
R9032:Ankib1 UTSW 5 3769641 missense probably benign 0.16
R9180:Ankib1 UTSW 5 3706276 missense probably damaging 1.00
R9325:Ankib1 UTSW 5 3772523 missense possibly damaging 0.81
R9474:Ankib1 UTSW 5 3755617 missense probably damaging 0.98
R9504:Ankib1 UTSW 5 3713235 missense probably benign
R9564:Ankib1 UTSW 5 3755733 missense possibly damaging 0.87
Z1088:Ankib1 UTSW 5 3713136 missense probably damaging 1.00
Z1088:Ankib1 UTSW 5 3713137 nonsense probably null
Z1176:Ankib1 UTSW 5 3692763 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTCATCTCTGAAGATAAAGCTGCC -3'
(R):5'- CACTGTCCTAAATGTCTTTGTAGC -3'

Sequencing Primer
(F):5'- TGACCAGGTTGAAATAAACTAATGC -3'
(R):5'- CCTAAATGTCTTTGTAGCTGAAGGAG -3'
Posted On 2021-03-08