Incidental Mutation 'T0970:Rnf26'
ID67262
Institutional Source Beutler Lab
Gene Symbol Rnf26
Ensembl Gene ENSMUSG00000053128
Gene Namering finger protein 26
Synonyms8030450I18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #T0970 (G3) of strain 713
Quality Score225
Status Validated
Chromosome9
Chromosomal Location44095631-44113517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 44112072 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 172 (R172P)
Ref Sequence ENSEMBL: ENSMUSP00000148925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034654] [ENSMUST00000056328] [ENSMUST00000065379] [ENSMUST00000114815] [ENSMUST00000114816] [ENSMUST00000114818] [ENSMUST00000114821] [ENSMUST00000152956] [ENSMUST00000161381] [ENSMUST00000162126] [ENSMUST00000185479] [ENSMUST00000205500] [ENSMUST00000206295] [ENSMUST00000206308] [ENSMUST00000206769] [ENSMUST00000215685] [ENSMUST00000216511]
Predicted Effect probably benign
Transcript: ENSMUST00000034654
SMART Domains Protein: ENSMUSP00000034654
Gene: ENSMUSG00000034739

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
CUB 150 259 3.6e-35 SMART
LDLa 265 302 1.5e-8 SMART
CUB 307 420 1.85e-37 SMART
Pfam:Fz 471 577 3e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056328
AA Change: R293P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110478
Gene: ENSMUSG00000053128
AA Change: R293P

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065379
AA Change: R293P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000070060
Gene: ENSMUSG00000053128
AA Change: R293P

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114815
SMART Domains Protein: ENSMUSP00000110463
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 235 2.09e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114816
SMART Domains Protein: ENSMUSP00000110464
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 235 2.09e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114818
SMART Domains Protein: ENSMUSP00000110466
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 235 2.09e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114821
SMART Domains Protein: ENSMUSP00000110469
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 220 1.01e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152956
SMART Domains Protein: ENSMUSP00000123040
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:Collagen 28 102 7.2e-10 PFAM
Pfam:C1q 105 138 1.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160985
SMART Domains Protein: ENSMUSP00000124568
Gene: ENSMUSG00000053128

DomainStartEndE-ValueType
RING 11 52 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161381
SMART Domains Protein: ENSMUSP00000124456
Gene: ENSMUSG00000034739

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
CUB 150 259 3.6e-35 SMART
LDLa 265 302 1.5e-8 SMART
CUB 307 420 1.85e-37 SMART
Pfam:Fz 465 576 9.1e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162126
AA Change: R293P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123938
Gene: ENSMUSG00000111409
AA Change: R293P

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181106
Predicted Effect probably damaging
Transcript: ENSMUST00000185479
AA Change: R293P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140405
Gene: ENSMUSG00000111409
AA Change: R293P

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205500
Predicted Effect probably benign
Transcript: ENSMUST00000206295
Predicted Effect probably benign
Transcript: ENSMUST00000206308
Predicted Effect probably benign
Transcript: ENSMUST00000206769
Predicted Effect silent
Transcript: ENSMUST00000215685
Predicted Effect probably damaging
Transcript: ENSMUST00000216511
AA Change: R172P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216960
Meta Mutation Damage Score 0.0861 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (25/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene contains a C3HC5 type of RING finger, a motif known to be involved in protein-DNA and protein-protein interactions. The expression of this gene was found to be upregulated in cancer cell lines derived from different types of cancer. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 A T 10: 88,981,190 L591* probably null Het
Aqp4 A G 18: 15,399,883 L51P probably damaging Het
Cemip A T 7: 83,983,146 C403S probably damaging Het
Cfap74 G T 4: 155,463,117 probably null Het
Glis3 G A 19: 28,530,932 R551W probably damaging Het
Gm11232 T A 4: 71,756,503 Y254F possibly damaging Het
Gm11492 A T 11: 87,567,732 T311S probably damaging Het
Map3k14 G T 11: 103,224,298 C837* probably null Het
Mrc2 A C 11: 105,347,627 E1200A probably benign Het
Nfix T C 8: 84,726,483 N314S possibly damaging Het
Nphp4 T C 4: 152,556,379 S1068P probably damaging Het
Nup98 A C 7: 102,186,752 probably benign Het
Olfr1340 A G 4: 118,726,267 R7G probably benign Het
Pcdhac2 T C 18: 37,145,335 V456A possibly damaging Het
Pcdhb1 G T 18: 37,265,973 G326C probably damaging Het
Prss38 A G 11: 59,373,148 V246A possibly damaging Het
Serinc3 TATCATC TATC 2: 163,627,915 probably benign Het
Spire1 C A 18: 67,501,063 probably null Het
Tex2 T A 11: 106,546,946 I633F unknown Het
Tle2 A G 10: 81,580,285 D108G possibly damaging Het
Txnrd2 T C 16: 18,441,773 V185A probably damaging Het
Unc45b C A 11: 82,922,888 H374N probably benign Het
Wtap T C 17: 12,969,390 probably benign Het
Other mutations in Rnf26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Rnf26 APN 9 44112859 missense probably benign 0.34
PIT1430001:Rnf26 UTSW 9 44112645 missense probably damaging 1.00
R4675:Rnf26 UTSW 9 44112131 missense probably benign 0.01
R5140:Rnf26 UTSW 9 44112774 intron probably null
Predicted Primers PCR Primer
(F):5'- GGCAGATAACACACTTCTTCCGCTC -3'
(R):5'- ATCTCCAGCAGTGCAGTGGCTATG -3'

Sequencing Primer
(F):5'- CATGGGTCCTGCCCAGC -3'
(R):5'- GGCCATTCTCCTGTGGAC -3'
Posted On2013-09-03