Incidental Mutation 'R8815:Ccdc27'
ID672656
Institutional Source Beutler Lab
Gene Symbol Ccdc27
Ensembl Gene ENSMUSG00000039492
Gene Namecoiled-coil domain containing 27
SynonymsLOC381580
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R8815 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location154026639-154042677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 154026748 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 636 (M636L)
Ref Sequence ENSEMBL: ENSMUSP00000039642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047207] [ENSMUST00000125533] [ENSMUST00000126119] [ENSMUST00000130175] [ENSMUST00000131325] [ENSMUST00000132541] [ENSMUST00000139569] [ENSMUST00000143047] [ENSMUST00000145527] [ENSMUST00000146054] [ENSMUST00000146426] [ENSMUST00000146543] [ENSMUST00000182151] [ENSMUST00000182191]
Predicted Effect probably benign
Transcript: ENSMUST00000047207
AA Change: M636L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000039642
Gene: ENSMUSG00000039492
AA Change: M636L

DomainStartEndE-ValueType
low complexity region 39 53 N/A INTRINSIC
coiled coil region 203 243 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 329 358 N/A INTRINSIC
coiled coil region 390 575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125533
SMART Domains Protein: ENSMUSP00000138324
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126119
SMART Domains Protein: ENSMUSP00000138560
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130175
SMART Domains Protein: ENSMUSP00000138675
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131325
SMART Domains Protein: ENSMUSP00000138777
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132541
SMART Domains Protein: ENSMUSP00000138471
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139569
Predicted Effect probably benign
Transcript: ENSMUST00000143047
SMART Domains Protein: ENSMUSP00000138733
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145527
SMART Domains Protein: ENSMUSP00000138448
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146054
SMART Domains Protein: ENSMUSP00000138605
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146426
Predicted Effect probably benign
Transcript: ENSMUST00000146543
SMART Domains Protein: ENSMUSP00000138267
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182151
SMART Domains Protein: ENSMUSP00000138692
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182191
SMART Domains Protein: ENSMUSP00000138710
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik A T 1: 57,382,784 Q106H probably damaging Het
A430078G23Rik C A 8: 3,380,410 H94Q probably benign Het
Acad9 T C 3: 36,085,441 C397R probably damaging Het
Ankfn1 T G 11: 89,391,776 R348S probably damaging Het
Ankrd61 A G 5: 143,894,518 C28R probably benign Het
Ano5 C T 7: 51,544,800 R94* probably null Het
Apela A T 8: 65,036,938 F10I unknown Het
Arhgap31 T C 16: 38,609,428 S362G probably benign Het
Astn2 A T 4: 65,912,597 L585Q possibly damaging Het
Atf3 G T 1: 191,177,367 A35D probably benign Het
Atp10b A T 11: 43,203,151 R507S possibly damaging Het
Brip1 A C 11: 86,189,772 V156G probably benign Het
Ceacam5 T A 7: 17,759,360 N769K possibly damaging Het
Cklf C T 8: 104,250,928 probably benign Het
Cpeb4 G A 11: 31,920,546 V474M probably damaging Het
Dip2c T A 13: 9,623,798 C1091* probably null Het
Eef1akmt4 T A 16: 20,618,538 I210N possibly damaging Het
Fbxo38 A T 18: 62,533,516 H195Q probably damaging Het
Fbxw14 G A 9: 109,276,237 R287* probably null Het
Fes A G 7: 80,383,871 S211P possibly damaging Het
Fry G T 5: 150,394,138 R861L possibly damaging Het
Gm14226 G A 2: 155,024,618 W165* probably null Het
Gm21671 A G 5: 25,953,193 S54P probably damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gprc6a A G 10: 51,620,983 V488A probably benign Het
Helb A T 10: 120,112,787 C26S possibly damaging Het
Icam1 A T 9: 21,026,566 I300F probably benign Het
Ip6k1 A G 9: 108,041,012 N181S probably benign Het
Itga2b C A 11: 102,460,861 R546L possibly damaging Het
Kif27 A T 13: 58,329,004 Y611N probably damaging Het
Lpcat2 A G 8: 92,914,351 I475V possibly damaging Het
Lrit2 A G 14: 37,072,530 K517R probably benign Het
Lrp1b A T 2: 40,665,159 I4085N Het
Lrrc32 T A 7: 98,499,035 S341T probably damaging Het
Lrrn2 T A 1: 132,939,093 I632K possibly damaging Het
Mettl22 A G 16: 8,482,314 Q194R probably benign Het
Mfhas1 T A 8: 35,590,240 V623E probably damaging Het
Mitd1 T C 1: 37,890,234 D26G probably damaging Het
Myo1a C T 10: 127,710,174 T222M probably benign Het
Naf1 A G 8: 66,864,681 K275R possibly damaging Het
Nf1 T C 11: 79,441,665 L765P probably damaging Het
Olfr198 T A 16: 59,201,901 H175L possibly damaging Het
Olfr360 G T 2: 37,068,417 M37I probably benign Het
Olfr68 A G 7: 103,777,856 L163P possibly damaging Het
Olfr823 T A 10: 130,111,939 I284F probably damaging Het
Pappa A G 4: 65,181,110 H622R probably benign Het
Pcdhb4 A T 18: 37,309,002 Y455F probably damaging Het
Pepd A G 7: 34,971,691 Y220C probably damaging Het
Pias3 T C 3: 96,700,065 I172T probably damaging Het
Polq T A 16: 37,033,531 H415Q probably damaging Het
Pp2d1 A T 17: 53,507,869 M609K probably benign Het
Prss22 T A 17: 23,996,688 T87S probably benign Het
Ptprf C A 4: 118,237,928 V254L possibly damaging Het
Ripply3 A G 16: 94,335,864 E128G possibly damaging Het
Rrm2 A C 12: 24,710,471 I185L possibly damaging Het
Sdc3 T A 4: 130,819,025 S232T probably benign Het
Slx4 G C 16: 3,985,594 P1119A probably benign Het
Smc5 C T 19: 23,244,058 R369Q probably damaging Het
Spns1 G A 7: 126,372,421 S319F possibly damaging Het
Sptbn4 G A 7: 27,407,232 Q924* probably null Het
Srcap G C 7: 127,558,865 D2638H unknown Het
Srsf12 T C 4: 33,226,045 S103P possibly damaging Het
Tanc1 A G 2: 59,790,841 T335A possibly damaging Het
Them4 C T 3: 94,324,303 T149I probably damaging Het
Trpc7 T C 13: 56,822,499 Y424C possibly damaging Het
Ttn A T 2: 76,867,900 L186H Het
Ttn C T 2: 76,798,020 D14599N probably damaging Het
Usp17lc T C 7: 103,418,317 F273S probably benign Het
Vwa5b2 T C 16: 20,600,766 S620P probably damaging Het
Other mutations in Ccdc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4466001:Ccdc27 UTSW 4 154041727 missense unknown
PIT4472001:Ccdc27 UTSW 4 154041727 missense unknown
R0078:Ccdc27 UTSW 4 154035738 splice site probably benign
R0883:Ccdc27 UTSW 4 154036484 missense unknown
R1389:Ccdc27 UTSW 4 154041769 missense unknown
R1773:Ccdc27 UTSW 4 154041765 missense unknown
R1869:Ccdc27 UTSW 4 154026763 splice site probably null
R2020:Ccdc27 UTSW 4 154033313 missense probably null 0.05
R2070:Ccdc27 UTSW 4 154041813 missense unknown
R2131:Ccdc27 UTSW 4 154036306 small deletion probably benign
R3825:Ccdc27 UTSW 4 154036285 missense unknown
R4183:Ccdc27 UTSW 4 154036306 small deletion probably benign
R4254:Ccdc27 UTSW 4 154039519 missense unknown
R5932:Ccdc27 UTSW 4 154026774 missense probably benign 0.22
R6269:Ccdc27 UTSW 4 154037722 missense unknown
R6324:Ccdc27 UTSW 4 154036191 missense probably benign 0.02
R6761:Ccdc27 UTSW 4 154037698 missense unknown
R7090:Ccdc27 UTSW 4 154028066 missense probably benign 0.03
R7163:Ccdc27 UTSW 4 154032825 missense not run
R7488:Ccdc27 UTSW 4 154032967 missense probably benign 0.22
R7555:Ccdc27 UTSW 4 154041817 missense unknown
R7651:Ccdc27 UTSW 4 154028099 missense probably damaging 1.00
R7826:Ccdc27 UTSW 4 154039501 critical splice donor site probably null
R8250:Ccdc27 UTSW 4 154041788 missense unknown
R8835:Ccdc27 UTSW 4 154042566 missense unknown
RF016:Ccdc27 UTSW 4 154036110 missense probably benign 0.04
Z1177:Ccdc27 UTSW 4 154036471 missense unknown
Predicted Primers PCR Primer
(F):5'- CCCAGCAGAAGTTTGGATCAG -3'
(R):5'- ACACACTTCAGAGGCAGAGATC -3'

Sequencing Primer
(F):5'- TTTGGATCAGAAGGAGCATGG -3'
(R):5'- TGCAGCAAGTCCTGGGGTG -3'
Posted On2021-04-30