Incidental Mutation 'R0736:Utp14b'
ID67278
Institutional Source Beutler Lab
Gene Symbol Utp14b
Ensembl Gene ENSMUSG00000079470
Gene NameUTP14B small subunit processome component
Synonyms4932411L21Rik, jsd
MMRRC Submission 038917-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0736 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location78658038-78671512 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78665272 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 296 (K296E)
Ref Sequence ENSEMBL: ENSMUSP00000121391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035779] [ENSMUST00000053760] [ENSMUST00000134566] [ENSMUST00000142704] [ENSMUST00000151622]
Predicted Effect probably benign
Transcript: ENSMUST00000035779
SMART Domains Protein: ENSMUSP00000045291
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000053760
AA Change: K296E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052149
Gene: ENSMUSG00000079470
AA Change: K296E

DomainStartEndE-ValueType
Pfam:Utp14 39 744 6.4e-205 PFAM
low complexity region 758 778 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134566
SMART Domains Protein: ENSMUSP00000117952
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
Pfam:AMP-binding 1 435 4.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142704
SMART Domains Protein: ENSMUSP00000121695
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2.5e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151622
AA Change: K296E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121391
Gene: ENSMUSG00000079470
AA Change: K296E

DomainStartEndE-ValueType
Pfam:Utp14 45 743 6e-163 PFAM
low complexity region 758 778 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous males are sterile with spermatogonial arrest and elevated intratesticular testosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,441,745 S702C probably damaging Het
Amn1 G A 6: 149,183,472 H37Y possibly damaging Het
BC027072 A G 17: 71,744,664 V1231A probably benign Het
Cacna2d3 A T 14: 29,058,628 H644Q probably benign Het
Calb1 G A 4: 15,898,917 V138M probably benign Het
Cep55 C A 19: 38,073,317 T402N probably benign Het
Chrnb3 G A 8: 27,385,050 A26T probably benign Het
Col6a3 C T 1: 90,804,089 V1481I possibly damaging Het
Dmxl2 C T 9: 54,378,817 V2695I probably damaging Het
Heatr5a A C 12: 51,896,561 probably null Het
Kmt2c C T 5: 25,295,434 M461I probably benign Het
Mapk9 G A 11: 49,883,254 D413N possibly damaging Het
Morc4 G T X: 139,854,951 Q239K probably benign Het
Myt1l T A 12: 29,827,814 V488D unknown Het
Neb A T 2: 52,192,012 Y24N probably damaging Het
Neo1 G A 9: 58,917,081 P688L possibly damaging Het
Nlrp9b A T 7: 20,049,450 D409V probably damaging Het
Pde7a T C 3: 19,231,043 N327D probably damaging Het
Pdzd8 C A 19: 59,344,933 V219L probably damaging Het
Pgc T A 17: 47,728,780 M33K probably damaging Het
Pik3ap1 T A 19: 41,332,319 T154S possibly damaging Het
Polm G C 11: 5,835,495 S188C possibly damaging Het
Slfn1 A T 11: 83,121,081 T8S probably benign Het
St8sia6 C T 2: 13,668,885 V179M probably benign Het
Tns3 A T 11: 8,519,474 F274I possibly damaging Het
Tspan5 T C 3: 138,868,398 probably null Het
Zbtb14 A G 17: 69,387,802 E165G possibly damaging Het
Zbtb17 C A 4: 141,461,786 H6N probably damaging Het
Zw10 C T 9: 49,064,132 H286Y probably benign Het
Other mutations in Utp14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Utp14b APN 1 78664545 missense probably damaging 1.00
IGL01837:Utp14b APN 1 78664919 missense probably damaging 1.00
IGL02895:Utp14b APN 1 78664607 missense possibly damaging 0.61
IGL03165:Utp14b APN 1 78664520 missense probably damaging 0.97
IGL03210:Utp14b APN 1 78665551 missense probably benign 0.02
R0662:Utp14b UTSW 1 78664999 missense probably damaging 1.00
R0671:Utp14b UTSW 1 78664735 missense probably benign 0.00
R1180:Utp14b UTSW 1 78665445 missense probably damaging 1.00
R1430:Utp14b UTSW 1 78666394 missense probably benign 0.25
R1448:Utp14b UTSW 1 78665445 missense probably damaging 1.00
R1641:Utp14b UTSW 1 78665939 missense probably benign 0.08
R1867:Utp14b UTSW 1 78665431 missense probably damaging 1.00
R3054:Utp14b UTSW 1 78664725 missense possibly damaging 0.91
R3055:Utp14b UTSW 1 78664725 missense possibly damaging 0.91
R3056:Utp14b UTSW 1 78664725 missense possibly damaging 0.91
R3426:Utp14b UTSW 1 78665339 missense probably damaging 1.00
R3744:Utp14b UTSW 1 78665256 missense probably benign 0.03
R4204:Utp14b UTSW 1 78664822 missense probably benign 0.12
R5570:Utp14b UTSW 1 78665401 missense probably damaging 1.00
R5574:Utp14b UTSW 1 78666409 missense probably damaging 1.00
R5958:Utp14b UTSW 1 78664942 nonsense probably null
R5958:Utp14b UTSW 1 78664943 missense probably damaging 1.00
R6173:Utp14b UTSW 1 78665837 missense probably benign 0.03
R6173:Utp14b UTSW 1 78665840 missense probably benign 0.00
R7258:Utp14b UTSW 1 78664974 missense probably benign 0.30
R7784:Utp14b UTSW 1 78664943 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAGATACGCCGAGCAGAGCTTCAG -3'
(R):5'- ATGGGCCACAAACTCAGGCATC -3'

Sequencing Primer
(F):5'- CAGAGCTTCAGAGGACGC -3'
(R):5'- CTGCTAAGCATCCAGGGATTTAC -3'
Posted On2013-09-03