Incidental Mutation 'R8851:Apoa4'
ID 675011
Institutional Source Beutler Lab
Gene Symbol Apoa4
Ensembl Gene ENSMUSG00000032080
Gene Name apolipoprotein A-IV
Synonyms Apoa-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock # R8851 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 46240696-46243459 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46242608 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 169 (K169R)
Ref Sequence ENSEMBL: ENSMUSP00000034585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034585]
AlphaFold P06728
Predicted Effect probably benign
Transcript: ENSMUST00000034585
AA Change: K169R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034585
Gene: ENSMUSG00000032080
AA Change: K169R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Apolipoprotein 61 213 1.1e-33 PFAM
Pfam:Apolipoprotein 182 338 9.1e-29 PFAM
Pfam:Apolipoprotein 298 390 7.4e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoliprotein (apo) A-IV gene contains 3 exons separated by two introns. A sequence polymorphism has been identified in the 3'UTR of the third exon. The primary translation product is a 396-residue preprotein which after proteolytic processing is secreted its primary site of synthesis, the intestine, in association with chylomicron particles. Although its precise function is not known, apo A-IV is a potent activator of lecithin-cholesterol acyltransferase in vitro. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene have lower HDL cholesterol levels but normal lipid absorption, growth, and feeding behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,332,116 I279F probably benign Het
Adamts7 A G 9: 90,193,110 N965S probably benign Het
Adgrl3 A G 5: 81,465,272 Y184C probably damaging Het
Ankar T C 1: 72,652,376 Y1142C probably damaging Het
AY761184 T A 8: 21,703,539 I22F possibly damaging Het
Cd22 T A 7: 30,877,659 K74N probably benign Het
Dgcr2 G A 16: 17,872,643 T41I possibly damaging Het
Dicer1 A G 12: 104,724,041 V245A possibly damaging Het
Dopey2 T A 16: 93,762,510 S715T probably benign Het
Epb41l1 A T 2: 156,522,511 H980L probably benign Het
Erc2 A T 14: 28,317,259 E973V probably null Het
Fam124b T A 1: 80,213,165 Q167L probably damaging Het
Frmpd2 A G 14: 33,495,686 E46G probably damaging Het
Gabrb2 G A 11: 42,421,359 V4I probably benign Het
Gbf1 T A 19: 46,268,483 N841K probably damaging Het
Gnpat A G 8: 124,874,265 H161R probably damaging Het
Gpd2 A T 2: 57,307,050 M206L possibly damaging Het
Grid2ip T C 5: 143,362,597 F148L possibly damaging Het
Hemk1 A G 9: 107,336,213 V128A probably benign Het
Ism1 G T 2: 139,749,545 S273I probably damaging Het
Kcnab3 G T 11: 69,328,164 probably null Het
Kdm6b A G 11: 69,401,167 Y1430H unknown Het
Lama2 A G 10: 27,366,123 V279A possibly damaging Het
Lmf1 G A 17: 25,585,706 W119* probably null Het
Lrrc42 A G 4: 107,239,178 V276A probably benign Het
Magi2 T C 5: 20,065,620 F163L probably damaging Het
Map2k2 A G 10: 81,119,263 K196R probably damaging Het
Mfsd11 C A 11: 116,861,653 D209E probably benign Het
Muc1 C A 3: 89,231,118 F422L probably benign Het
Muc13 A G 16: 33,810,903 H391R probably benign Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Nfatc2ip T C 7: 126,387,445 Q346R probably damaging Het
Olfr971 A G 9: 39,840,304 Y290C probably damaging Het
Otol1 T A 3: 70,027,966 D430E probably damaging Het
Pcdh1 T C 18: 38,192,102 E929G probably damaging Het
Plekhf1 C T 7: 38,222,042 R34H probably damaging Het
Plekhm2 A T 4: 141,631,328 V622E probably benign Het
Pomt2 G A 12: 87,138,064 T196I probably damaging Het
Ppp1r12c C T 7: 4,484,704 G436D probably damaging Het
Prss50 A G 9: 110,858,013 probably benign Het
Slc29a1 A G 17: 45,589,476 I176T probably damaging Het
Slc5a9 A T 4: 111,898,593 V36E probably damaging Het
Slc7a1 A C 5: 148,348,283 S133R probably damaging Het
Sox17 A G 1: 4,491,850 Y376H probably benign Het
Spata4 T C 8: 54,609,900 I280T probably benign Het
Svop T A 5: 114,054,496 I187F probably damaging Het
Tas2r103 T A 6: 133,036,933 I57F Het
Tead3 A G 17: 28,332,730 V463A probably damaging Het
Tenm4 G C 7: 96,852,503 G1305R probably damaging Het
Tmem55a T C 4: 14,912,491 M200T possibly damaging Het
Top2a A T 11: 99,009,851 F594L probably damaging Het
Trim23 A G 13: 104,198,065 T419A possibly damaging Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Ttyh2 A G 11: 114,702,264 I254V probably benign Het
Vmn2r58 T C 7: 41,837,795 M559V probably benign Het
Wwp1 A T 4: 19,643,437 H358Q probably null Het
Zcwpw1 A C 5: 137,822,364 D597A probably damaging Het
Zfp318 A T 17: 46,399,835 Y828F probably damaging Het
Zfp608 T A 18: 54,899,122 N582I possibly damaging Het
Other mutations in Apoa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01574:Apoa4 APN 9 46242985 missense probably benign 0.30
IGL02321:Apoa4 APN 9 46242920 missense probably damaging 0.98
R0001:Apoa4 UTSW 9 46242892 missense probably benign 0.03
R0054:Apoa4 UTSW 9 46242524 missense probably benign 0.00
R0054:Apoa4 UTSW 9 46242524 missense probably benign 0.00
R0401:Apoa4 UTSW 9 46243058 missense probably damaging 1.00
R1446:Apoa4 UTSW 9 46242293 missense probably benign 0.03
R2027:Apoa4 UTSW 9 46243000 missense probably damaging 1.00
R2332:Apoa4 UTSW 9 46242355 missense probably benign 0.00
R4979:Apoa4 UTSW 9 46241505 missense probably benign 0.01
R5120:Apoa4 UTSW 9 46242737 missense probably damaging 1.00
R5780:Apoa4 UTSW 9 46242592 missense possibly damaging 0.77
R6769:Apoa4 UTSW 9 46243167 missense probably benign 0.01
R6771:Apoa4 UTSW 9 46243167 missense probably benign 0.01
R7009:Apoa4 UTSW 9 46242880 missense possibly damaging 0.82
R7384:Apoa4 UTSW 9 46241474 missense not run
R7625:Apoa4 UTSW 9 46243112 missense probably damaging 0.99
R8039:Apoa4 UTSW 9 46242293 missense possibly damaging 0.70
R8305:Apoa4 UTSW 9 46241155 start codon destroyed probably null 1.00
R9032:Apoa4 UTSW 9 46242977 missense probably damaging 1.00
Z1176:Apoa4 UTSW 9 46242589 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACAGCTGAGTGGGCATCTAG -3'
(R):5'- TGGTTGAGTTTCTCCTGCAC -3'

Sequencing Primer
(F):5'- ACCTACGTGACCGCATGATG -3'
(R):5'- GTTTCTCCTGCACGCCCAC -3'
Posted On 2021-07-15