Incidental Mutation 'R8851:Ankar'
ID 674980
Institutional Source Beutler Lab
Gene Symbol Ankar
Ensembl Gene ENSMUSG00000039342
Gene Name ankyrin and armadillo repeat containing
Synonyms 4932422E22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8851 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 72642980-72700579 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72652376 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1142 (Y1142C)
Ref Sequence ENSEMBL: ENSMUSP00000054056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]
AlphaFold A2RT91
Predicted Effect probably damaging
Transcript: ENSMUST00000053499
AA Change: Y1142C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342
AA Change: Y1142C

DomainStartEndE-ValueType
low complexity region 46 51 N/A INTRINSIC
low complexity region 484 496 N/A INTRINSIC
ANK 532 561 1.25e2 SMART
ANK 582 611 3.49e0 SMART
ANK 615 644 4.44e2 SMART
ANK 651 680 3.8e-1 SMART
ANK 684 714 9.87e0 SMART
ARM 744 784 5.96e-3 SMART
ARM 785 825 4.09e0 SMART
Blast:ARM 827 865 1e-15 BLAST
ARM 867 907 8.34e0 SMART
ARM 909 949 8.34e0 SMART
Blast:ARM 951 991 2e-13 BLAST
ARM 1034 1077 4.82e1 SMART
ARM 1084 1123 1.3e1 SMART
ARM 1257 1297 6.01e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000211837
AA Change: Y1141C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,332,116 I279F probably benign Het
Adamts7 A G 9: 90,193,110 N965S probably benign Het
Adgrl3 A G 5: 81,465,272 Y184C probably damaging Het
Apoa4 A G 9: 46,242,608 K169R probably benign Het
AY761184 T A 8: 21,703,539 I22F possibly damaging Het
Cd22 T A 7: 30,877,659 K74N probably benign Het
Dgcr2 G A 16: 17,872,643 T41I possibly damaging Het
Dicer1 A G 12: 104,724,041 V245A possibly damaging Het
Dopey2 T A 16: 93,762,510 S715T probably benign Het
Epb41l1 A T 2: 156,522,511 H980L probably benign Het
Erc2 A T 14: 28,317,259 E973V probably null Het
Fam124b T A 1: 80,213,165 Q167L probably damaging Het
Frmpd2 A G 14: 33,495,686 E46G probably damaging Het
Gabrb2 G A 11: 42,421,359 V4I probably benign Het
Gbf1 T A 19: 46,268,483 N841K probably damaging Het
Gnpat A G 8: 124,874,265 H161R probably damaging Het
Gpd2 A T 2: 57,307,050 M206L possibly damaging Het
Grid2ip T C 5: 143,362,597 F148L possibly damaging Het
Hemk1 A G 9: 107,336,213 V128A probably benign Het
Ism1 G T 2: 139,749,545 S273I probably damaging Het
Kcnab3 G T 11: 69,328,164 probably null Het
Kdm6b A G 11: 69,401,167 Y1430H unknown Het
Lama2 A G 10: 27,366,123 V279A possibly damaging Het
Lmf1 G A 17: 25,585,706 W119* probably null Het
Lrrc42 A G 4: 107,239,178 V276A probably benign Het
Magi2 T C 5: 20,065,620 F163L probably damaging Het
Map2k2 A G 10: 81,119,263 K196R probably damaging Het
Mfsd11 C A 11: 116,861,653 D209E probably benign Het
Muc1 C A 3: 89,231,118 F422L probably benign Het
Muc13 A G 16: 33,810,903 H391R probably benign Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Nfatc2ip T C 7: 126,387,445 Q346R probably damaging Het
Olfr971 A G 9: 39,840,304 Y290C probably damaging Het
Otol1 T A 3: 70,027,966 D430E probably damaging Het
Pcdh1 T C 18: 38,192,102 E929G probably damaging Het
Plekhf1 C T 7: 38,222,042 R34H probably damaging Het
Plekhm2 A T 4: 141,631,328 V622E probably benign Het
Pomt2 G A 12: 87,138,064 T196I probably damaging Het
Ppp1r12c C T 7: 4,484,704 G436D probably damaging Het
Prss50 A G 9: 110,858,013 probably benign Het
Slc29a1 A G 17: 45,589,476 I176T probably damaging Het
Slc5a9 A T 4: 111,898,593 V36E probably damaging Het
Slc7a1 A C 5: 148,348,283 S133R probably damaging Het
Sox17 A G 1: 4,491,850 Y376H probably benign Het
Spata4 T C 8: 54,609,900 I280T probably benign Het
Svop T A 5: 114,054,496 I187F probably damaging Het
Tas2r103 T A 6: 133,036,933 I57F Het
Tead3 A G 17: 28,332,730 V463A probably damaging Het
Tenm4 G C 7: 96,852,503 G1305R probably damaging Het
Tmem55a T C 4: 14,912,491 M200T possibly damaging Het
Top2a A T 11: 99,009,851 F594L probably damaging Het
Trim23 A G 13: 104,198,065 T419A possibly damaging Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Ttyh2 A G 11: 114,702,264 I254V probably benign Het
Vmn2r58 T C 7: 41,837,795 M559V probably benign Het
Wwp1 A T 4: 19,643,437 H358Q probably null Het
Zcwpw1 A C 5: 137,822,364 D597A probably damaging Het
Zfp318 A T 17: 46,399,835 Y828F probably damaging Het
Zfp608 T A 18: 54,899,122 N582I possibly damaging Het
Other mutations in Ankar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ankar APN 1 72690131 missense probably damaging 1.00
IGL01013:Ankar APN 1 72650989 missense possibly damaging 0.90
IGL01135:Ankar APN 1 72665219 missense probably benign 0.28
IGL01824:Ankar APN 1 72651727 missense probably benign 0.40
IGL01885:Ankar APN 1 72658703 missense probably damaging 1.00
IGL01932:Ankar APN 1 72698987 missense probably benign 0.25
IGL02143:Ankar APN 1 72658649 critical splice donor site probably null
IGL02326:Ankar APN 1 72666355 missense probably damaging 1.00
IGL02445:Ankar APN 1 72666365 missense probably benign 0.05
IGL02606:Ankar APN 1 72690285 missense possibly damaging 0.61
IGL02635:Ankar APN 1 72652431 missense possibly damaging 0.93
IGL02680:Ankar APN 1 72670116 missense probably damaging 1.00
IGL02704:Ankar APN 1 72652343 missense possibly damaging 0.88
IGL03086:Ankar APN 1 72643278 missense possibly damaging 0.84
IGL03269:Ankar APN 1 72665201 missense probably damaging 0.99
IGL03368:Ankar APN 1 72675813 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0488:Ankar UTSW 1 72658732 missense probably damaging 1.00
R0650:Ankar UTSW 1 72656221 splice site probably benign
R1121:Ankar UTSW 1 72651663 splice site probably null
R1163:Ankar UTSW 1 72688705 missense possibly damaging 0.82
R1300:Ankar UTSW 1 72643164 missense probably benign 0.00
R1309:Ankar UTSW 1 72674004 missense possibly damaging 0.59
R1366:Ankar UTSW 1 72698649 missense probably damaging 1.00
R1456:Ankar UTSW 1 72665118 missense probably benign 0.34
R1495:Ankar UTSW 1 72643291 missense probably benign
R1583:Ankar UTSW 1 72679555 splice site probably benign
R1635:Ankar UTSW 1 72650138 missense probably damaging 0.99
R1975:Ankar UTSW 1 72658441 missense possibly damaging 0.95
R2036:Ankar UTSW 1 72666530 nonsense probably null
R2511:Ankar UTSW 1 72658694 missense probably damaging 1.00
R2965:Ankar UTSW 1 72675820 missense probably benign 0.00
R3404:Ankar UTSW 1 72643093 nonsense probably null
R3417:Ankar UTSW 1 72658976 critical splice donor site probably null
R4072:Ankar UTSW 1 72688592 missense probably damaging 1.00
R4231:Ankar UTSW 1 72658542 missense probably benign 0.23
R4447:Ankar UTSW 1 72687789 missense possibly damaging 0.60
R4632:Ankar UTSW 1 72647184 missense probably benign 0.01
R4720:Ankar UTSW 1 72699011 missense possibly damaging 0.55
R4754:Ankar UTSW 1 72698694 missense probably damaging 1.00
R4884:Ankar UTSW 1 72698807 missense probably damaging 0.97
R5068:Ankar UTSW 1 72680210 splice site probably null
R5069:Ankar UTSW 1 72680210 splice site probably null
R5070:Ankar UTSW 1 72680210 splice site probably null
R5189:Ankar UTSW 1 72658414 missense probably benign 0.01
R5247:Ankar UTSW 1 72680184 missense probably benign 0.08
R5322:Ankar UTSW 1 72690386 splice site probably null
R5345:Ankar UTSW 1 72670151 missense possibly damaging 0.94
R5864:Ankar UTSW 1 72659165 missense probably benign 0.00
R5976:Ankar UTSW 1 72643291 missense probably benign
R6003:Ankar UTSW 1 72698887 missense probably damaging 1.00
R6042:Ankar UTSW 1 72674054 nonsense probably null
R6296:Ankar UTSW 1 72643258 missense probably damaging 1.00
R6488:Ankar UTSW 1 72681808 critical splice donor site probably null
R6885:Ankar UTSW 1 72643036 missense unknown
R6985:Ankar UTSW 1 72658482 missense probably damaging 1.00
R7060:Ankar UTSW 1 72656113 missense probably benign 0.18
R7099:Ankar UTSW 1 72643293 missense probably damaging 0.99
R7194:Ankar UTSW 1 72659033 missense probably benign 0.32
R7221:Ankar UTSW 1 72650231 missense probably damaging 1.00
R7222:Ankar UTSW 1 72666355 missense probably damaging 0.99
R7258:Ankar UTSW 1 72651727 missense probably benign 0.40
R7303:Ankar UTSW 1 72659033 missense probably benign 0.32
R7308:Ankar UTSW 1 72651794 nonsense probably null
R7384:Ankar UTSW 1 72658465 missense probably benign 0.00
R7424:Ankar UTSW 1 72680058 missense probably damaging 1.00
R7464:Ankar UTSW 1 72698894 missense possibly damaging 0.94
R7525:Ankar UTSW 1 72688641 missense probably benign 0.18
R7618:Ankar UTSW 1 72675766 missense probably benign 0.22
R7659:Ankar UTSW 1 72690135 missense possibly damaging 0.95
R7974:Ankar UTSW 1 72698979 nonsense probably null
R8008:Ankar UTSW 1 72666484 missense possibly damaging 0.47
R8119:Ankar UTSW 1 72647001 missense probably damaging 0.98
R8244:Ankar UTSW 1 72651024 missense probably benign
R8342:Ankar UTSW 1 72652460 missense probably damaging 1.00
R8494:Ankar UTSW 1 72658794 missense probably benign 0.16
R8970:Ankar UTSW 1 72652337 critical splice donor site probably null
R9228:Ankar UTSW 1 72674051 missense probably benign 0.27
Z1176:Ankar UTSW 1 72689961 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCCTGTCTTCCTTGGAAAATTTG -3'
(R):5'- CCTGCAGAAGCTGTGTTAGTC -3'

Sequencing Primer
(F):5'- TCATGACCTACAAAGAGACATTTTG -3'
(R):5'- ACCATGCTTTAAAACCCTTTATAACC -3'
Posted On 2021-07-15