Mutagenetix > Incidental Mutation

Incidental Mutation 'R8851:Ankar'

674980

Institutional Source

Beutler Lab

Gene Symbol

Ankar

Ensembl Gene

ENSMUSG00000039342

Gene Name

ankyrin and armadillo repeat containing

Synonyms

4932422E22Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R8851 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

72642980-72700579 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 72652376 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1142 (Y1142C)

Ref Sequence

ENSEMBL: ENSMUSP00000054056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]

AlphaFold

A2RT91

Predicted Effect

probably damaging
Transcript: ENSMUST00000053499
AA Change: Y1142C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342
AA Change: Y1142C

Domain	Start	End	E-Value	Type
low complexity region	46	51	N/A	INTRINSIC
low complexity region	484	496	N/A	INTRINSIC
ANK	532	561	1.25e2	SMART
ANK	582	611	3.49e0	SMART
ANK	615	644	4.44e2	SMART
ANK	651	680	3.8e-1	SMART
ANK	684	714	9.87e0	SMART
ARM	744	784	5.96e-3	SMART
ARM	785	825	4.09e0	SMART
Blast:ARM	827	865	1e-15	BLAST
ARM	867	907	8.34e0	SMART
ARM	909	949	8.34e0	SMART
Blast:ARM	951	991	2e-13	BLAST
ARM	1034	1077	4.82e1	SMART
ARM	1084	1123	1.3e1	SMART
ARM	1257	1297	6.01e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000211837
AA Change: Y1141C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr1	T	A	1: 173,332,116	I279F	probably benign	Het
Adamts7	A	G	9: 90,193,110	N965S	probably benign	Het
Adgrl3	A	G	5: 81,465,272	Y184C	probably damaging	Het
Apoa4	A	G	9: 46,242,608	K169R	probably benign	Het
AY761184	T	A	8: 21,703,539	I22F	possibly damaging	Het
Cd22	T	A	7: 30,877,659	K74N	probably benign	Het
Dgcr2	G	A	16: 17,872,643	T41I	possibly damaging	Het
Dicer1	A	G	12: 104,724,041	V245A	possibly damaging	Het
Dopey2	T	A	16: 93,762,510	S715T	probably benign	Het
Epb41l1	A	T	2: 156,522,511	H980L	probably benign	Het
Erc2	A	T	14: 28,317,259	E973V	probably null	Het
Fam124b	T	A	1: 80,213,165	Q167L	probably damaging	Het
Frmpd2	A	G	14: 33,495,686	E46G	probably damaging	Het
Gabrb2	G	A	11: 42,421,359	V4I	probably benign	Het
Gbf1	T	A	19: 46,268,483	N841K	probably damaging	Het
Gnpat	A	G	8: 124,874,265	H161R	probably damaging	Het
Gpd2	A	T	2: 57,307,050	M206L	possibly damaging	Het
Grid2ip	T	C	5: 143,362,597	F148L	possibly damaging	Het
Hemk1	A	G	9: 107,336,213	V128A	probably benign	Het
Ism1	G	T	2: 139,749,545	S273I	probably damaging	Het
Kcnab3	G	T	11: 69,328,164		probably null	Het
Kdm6b	A	G	11: 69,401,167	Y1430H	unknown	Het
Lama2	A	G	10: 27,366,123	V279A	possibly damaging	Het
Lmf1	G	A	17: 25,585,706	W119*	probably null	Het
Lrrc42	A	G	4: 107,239,178	V276A	probably benign	Het
Magi2	T	C	5: 20,065,620	F163L	probably damaging	Het
Map2k2	A	G	10: 81,119,263	K196R	probably damaging	Het
Mfsd11	C	A	11: 116,861,653	D209E	probably benign	Het
Muc1	C	A	3: 89,231,118	F422L	probably benign	Het
Muc13	A	G	16: 33,810,903	H391R	probably benign	Het
Mxi1	G	A	19: 53,371,695	G283S	probably damaging	Het
Nfatc2ip	T	C	7: 126,387,445	Q346R	probably damaging	Het
Olfr971	A	G	9: 39,840,304	Y290C	probably damaging	Het
Otol1	T	A	3: 70,027,966	D430E	probably damaging	Het
Pcdh1	T	C	18: 38,192,102	E929G	probably damaging	Het
Plekhf1	C	T	7: 38,222,042	R34H	probably damaging	Het
Plekhm2	A	T	4: 141,631,328	V622E	probably benign	Het
Pomt2	G	A	12: 87,138,064	T196I	probably damaging	Het
Ppp1r12c	C	T	7: 4,484,704	G436D	probably damaging	Het
Prss50	A	G	9: 110,858,013		probably benign	Het
Slc29a1	A	G	17: 45,589,476	I176T	probably damaging	Het
Slc5a9	A	T	4: 111,898,593	V36E	probably damaging	Het
Slc7a1	A	C	5: 148,348,283	S133R	probably damaging	Het
Sox17	A	G	1: 4,491,850	Y376H	probably benign	Het
Spata4	T	C	8: 54,609,900	I280T	probably benign	Het
Svop	T	A	5: 114,054,496	I187F	probably damaging	Het
Tas2r103	T	A	6: 133,036,933	I57F		Het
Tead3	A	G	17: 28,332,730	V463A	probably damaging	Het
Tenm4	G	C	7: 96,852,503	G1305R	probably damaging	Het
Tmem55a	T	C	4: 14,912,491	M200T	possibly damaging	Het
Top2a	A	T	11: 99,009,851	F594L	probably damaging	Het
Trim23	A	G	13: 104,198,065	T419A	possibly damaging	Het
Ttn	T	C	2: 76,798,893	E12621G	probably damaging	Het
Ttyh2	A	G	11: 114,702,264	I254V	probably benign	Het
Vmn2r58	T	C	7: 41,837,795	M559V	probably benign	Het
Wwp1	A	T	4: 19,643,437	H358Q	probably null	Het
Zcwpw1	A	C	5: 137,822,364	D597A	probably damaging	Het
Zfp318	A	T	17: 46,399,835	Y828F	probably damaging	Het
Zfp608	T	A	18: 54,899,122	N582I	possibly damaging	Het

Other mutations in Ankar

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00338:Ankar	APN	1	72690131	missense	probably damaging	1.00
IGL01013:Ankar	APN	1	72650989	missense	possibly damaging	0.90
IGL01135:Ankar	APN	1	72665219	missense	probably benign	0.28
IGL01824:Ankar	APN	1	72651727	missense	probably benign	0.40
IGL01885:Ankar	APN	1	72658703	missense	probably damaging	1.00
IGL01932:Ankar	APN	1	72698987	missense	probably benign	0.25
IGL02143:Ankar	APN	1	72658649	critical splice donor site	probably null
IGL02326:Ankar	APN	1	72666355	missense	probably damaging	1.00
IGL02445:Ankar	APN	1	72666365	missense	probably benign	0.05
IGL02606:Ankar	APN	1	72690285	missense	possibly damaging	0.61
IGL02635:Ankar	APN	1	72652431	missense	possibly damaging	0.93
IGL02680:Ankar	APN	1	72670116	missense	probably damaging	1.00
IGL02704:Ankar	APN	1	72652343	missense	possibly damaging	0.88
IGL03086:Ankar	APN	1	72643278	missense	possibly damaging	0.84
IGL03269:Ankar	APN	1	72665201	missense	probably damaging	0.99
IGL03368:Ankar	APN	1	72675813	missense	probably damaging	1.00
R0050:Ankar	UTSW	1	72656164	missense	probably damaging	1.00
R0050:Ankar	UTSW	1	72656164	missense	probably damaging	1.00
R0488:Ankar	UTSW	1	72658732	missense	probably damaging	1.00
R0650:Ankar	UTSW	1	72656221	splice site	probably benign
R1121:Ankar	UTSW	1	72651663	splice site	probably null
R1163:Ankar	UTSW	1	72688705	missense	possibly damaging	0.82
R1300:Ankar	UTSW	1	72643164	missense	probably benign	0.00
R1309:Ankar	UTSW	1	72674004	missense	possibly damaging	0.59
R1366:Ankar	UTSW	1	72698649	missense	probably damaging	1.00
R1456:Ankar	UTSW	1	72665118	missense	probably benign	0.34
R1495:Ankar	UTSW	1	72643291	missense	probably benign
R1583:Ankar	UTSW	1	72679555	splice site	probably benign
R1635:Ankar	UTSW	1	72650138	missense	probably damaging	0.99
R1975:Ankar	UTSW	1	72658441	missense	possibly damaging	0.95
R2036:Ankar	UTSW	1	72666530	nonsense	probably null
R2511:Ankar	UTSW	1	72658694	missense	probably damaging	1.00
R2965:Ankar	UTSW	1	72675820	missense	probably benign	0.00
R3404:Ankar	UTSW	1	72643093	nonsense	probably null
R3417:Ankar	UTSW	1	72658976	critical splice donor site	probably null
R4072:Ankar	UTSW	1	72688592	missense	probably damaging	1.00
R4231:Ankar	UTSW	1	72658542	missense	probably benign	0.23
R4447:Ankar	UTSW	1	72687789	missense	possibly damaging	0.60
R4632:Ankar	UTSW	1	72647184	missense	probably benign	0.01
R4720:Ankar	UTSW	1	72699011	missense	possibly damaging	0.55
R4754:Ankar	UTSW	1	72698694	missense	probably damaging	1.00
R4884:Ankar	UTSW	1	72698807	missense	probably damaging	0.97
R5068:Ankar	UTSW	1	72680210	splice site	probably null
R5069:Ankar	UTSW	1	72680210	splice site	probably null
R5070:Ankar	UTSW	1	72680210	splice site	probably null
R5189:Ankar	UTSW	1	72658414	missense	probably benign	0.01
R5247:Ankar	UTSW	1	72680184	missense	probably benign	0.08
R5322:Ankar	UTSW	1	72690386	splice site	probably null
R5345:Ankar	UTSW	1	72670151	missense	possibly damaging	0.94
R5864:Ankar	UTSW	1	72659165	missense	probably benign	0.00
R5976:Ankar	UTSW	1	72643291	missense	probably benign
R6003:Ankar	UTSW	1	72698887	missense	probably damaging	1.00
R6042:Ankar	UTSW	1	72674054	nonsense	probably null
R6296:Ankar	UTSW	1	72643258	missense	probably damaging	1.00
R6488:Ankar	UTSW	1	72681808	critical splice donor site	probably null
R6885:Ankar	UTSW	1	72643036	missense	unknown
R6985:Ankar	UTSW	1	72658482	missense	probably damaging	1.00
R7060:Ankar	UTSW	1	72656113	missense	probably benign	0.18
R7099:Ankar	UTSW	1	72643293	missense	probably damaging	0.99
R7194:Ankar	UTSW	1	72659033	missense	probably benign	0.32
R7221:Ankar	UTSW	1	72650231	missense	probably damaging	1.00
R7222:Ankar	UTSW	1	72666355	missense	probably damaging	0.99
R7258:Ankar	UTSW	1	72651727	missense	probably benign	0.40
R7303:Ankar	UTSW	1	72659033	missense	probably benign	0.32
R7308:Ankar	UTSW	1	72651794	nonsense	probably null
R7384:Ankar	UTSW	1	72658465	missense	probably benign	0.00
R7424:Ankar	UTSW	1	72680058	missense	probably damaging	1.00
R7464:Ankar	UTSW	1	72698894	missense	possibly damaging	0.94
R7525:Ankar	UTSW	1	72688641	missense	probably benign	0.18
R7618:Ankar	UTSW	1	72675766	missense	probably benign	0.22
R7659:Ankar	UTSW	1	72690135	missense	possibly damaging	0.95
R7974:Ankar	UTSW	1	72698979	nonsense	probably null
R8008:Ankar	UTSW	1	72666484	missense	possibly damaging	0.47
R8119:Ankar	UTSW	1	72647001	missense	probably damaging	0.98
R8244:Ankar	UTSW	1	72651024	missense	probably benign
R8342:Ankar	UTSW	1	72652460	missense	probably damaging	1.00
R8494:Ankar	UTSW	1	72658794	missense	probably benign	0.16
R8970:Ankar	UTSW	1	72652337	critical splice donor site	probably null
R9228:Ankar	UTSW	1	72674051	missense	probably benign	0.27
R9511:Ankar	UTSW	1	72680002	missense	probably benign	0.23
R9577:Ankar	UTSW	1	72681908	missense	probably benign	0.02
R9612:Ankar	UTSW	1	72665135	missense	possibly damaging	0.65
R9647:Ankar	UTSW	1	72650148	missense	probably damaging	1.00
R9803:Ankar	UTSW	1	72659181	missense	possibly damaging	0.47
Z1176:Ankar	UTSW	1	72689961	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TGCCTGTCTTCCTTGGAAAATTTG -3'
(R):5'- CCTGCAGAAGCTGTGTTAGTC -3'

Sequencing Primer
(F):5'- TCATGACCTACAAAGAGACATTTTG -3'
(R):5'- ACCATGCTTTAAAACCCTTTATAACC -3'

Posted On

2021-07-15