Incidental Mutation 'R8851:Ankar'
ID 674980
Institutional Source Beutler Lab
Gene Symbol Ankar
Ensembl Gene ENSMUSG00000039342
Gene Name ankyrin and armadillo repeat containing
Synonyms 4932422E22Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8851 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 72642980-72700579 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72652376 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1142 (Y1142C)
Ref Sequence ENSEMBL: ENSMUSP00000054056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]
AlphaFold A2RT91
Predicted Effect probably damaging
Transcript: ENSMUST00000053499
AA Change: Y1142C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342
AA Change: Y1142C

DomainStartEndE-ValueType
low complexity region 46 51 N/A INTRINSIC
low complexity region 484 496 N/A INTRINSIC
ANK 532 561 1.25e2 SMART
ANK 582 611 3.49e0 SMART
ANK 615 644 4.44e2 SMART
ANK 651 680 3.8e-1 SMART
ANK 684 714 9.87e0 SMART
ARM 744 784 5.96e-3 SMART
ARM 785 825 4.09e0 SMART
Blast:ARM 827 865 1e-15 BLAST
ARM 867 907 8.34e0 SMART
ARM 909 949 8.34e0 SMART
Blast:ARM 951 991 2e-13 BLAST
ARM 1034 1077 4.82e1 SMART
ARM 1084 1123 1.3e1 SMART
ARM 1257 1297 6.01e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000211837
AA Change: Y1141C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,332,116 I279F probably benign Het
Adamts7 A G 9: 90,193,110 N965S probably benign Het
Adgrl3 A G 5: 81,465,272 Y184C probably damaging Het
Apoa4 A G 9: 46,242,608 K169R probably benign Het
AY761184 T A 8: 21,703,539 I22F possibly damaging Het
Cd22 T A 7: 30,877,659 K74N probably benign Het
Dgcr2 G A 16: 17,872,643 T41I possibly damaging Het
Dicer1 A G 12: 104,724,041 V245A possibly damaging Het
Dopey2 T A 16: 93,762,510 S715T probably benign Het
Epb41l1 A T 2: 156,522,511 H980L probably benign Het
Erc2 A T 14: 28,317,259 E973V probably null Het
Fam124b T A 1: 80,213,165 Q167L probably damaging Het
Frmpd2 A G 14: 33,495,686 E46G probably damaging Het
Gabrb2 G A 11: 42,421,359 V4I probably benign Het
Gbf1 T A 19: 46,268,483 N841K probably damaging Het
Gnpat A G 8: 124,874,265 H161R probably damaging Het
Gpd2 A T 2: 57,307,050 M206L possibly damaging Het
Grid2ip T C 5: 143,362,597 F148L possibly damaging Het
Hemk1 A G 9: 107,336,213 V128A probably benign Het
Ism1 G T 2: 139,749,545 S273I probably damaging Het
Kcnab3 G T 11: 69,328,164 probably null Het
Kdm6b A G 11: 69,401,167 Y1430H unknown Het
Lama2 A G 10: 27,366,123 V279A possibly damaging Het
Lmf1 G A 17: 25,585,706 W119* probably null Het
Lrrc42 A G 4: 107,239,178 V276A probably benign Het
Magi2 T C 5: 20,065,620 F163L probably damaging Het
Map2k2 A G 10: 81,119,263 K196R probably damaging Het
Mfsd11 C A 11: 116,861,653 D209E probably benign Het
Muc1 C A 3: 89,231,118 F422L probably benign Het
Muc13 A G 16: 33,810,903 H391R probably benign Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Nfatc2ip T C 7: 126,387,445 Q346R probably damaging Het
Olfr971 A G 9: 39,840,304 Y290C probably damaging Het
Otol1 T A 3: 70,027,966 D430E probably damaging Het
Pcdh1 T C 18: 38,192,102 E929G probably damaging Het
Plekhf1 C T 7: 38,222,042 R34H probably damaging Het
Plekhm2 A T 4: 141,631,328 V622E probably benign Het
Pomt2 G A 12: 87,138,064 T196I probably damaging Het
Ppp1r12c C T 7: 4,484,704 G436D probably damaging Het
Prss50 A G 9: 110,858,013 probably benign Het
Slc29a1 A G 17: 45,589,476 I176T probably damaging Het
Slc5a9 A T 4: 111,898,593 V36E probably damaging Het
Slc7a1 A C 5: 148,348,283 S133R probably damaging Het
Sox17 A G 1: 4,491,850 Y376H probably benign Het
Spata4 T C 8: 54,609,900 I280T probably benign Het
Svop T A 5: 114,054,496 I187F probably damaging Het
Tas2r103 T A 6: 133,036,933 I57F Het
Tead3 A G 17: 28,332,730 V463A probably damaging Het
Tenm4 G C 7: 96,852,503 G1305R probably damaging Het
Tmem55a T C 4: 14,912,491 M200T possibly damaging Het
Top2a A T 11: 99,009,851 F594L probably damaging Het
Trim23 A G 13: 104,198,065 T419A possibly damaging Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Ttyh2 A G 11: 114,702,264 I254V probably benign Het
Vmn2r58 T C 7: 41,837,795 M559V probably benign Het
Wwp1 A T 4: 19,643,437 H358Q probably null Het
Zcwpw1 A C 5: 137,822,364 D597A probably damaging Het
Zfp318 A T 17: 46,399,835 Y828F probably damaging Het
Zfp608 T A 18: 54,899,122 N582I possibly damaging Het
Other mutations in Ankar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ankar APN 1 72690131 missense probably damaging 1.00
IGL01013:Ankar APN 1 72650989 missense possibly damaging 0.90
IGL01135:Ankar APN 1 72665219 missense probably benign 0.28
IGL01824:Ankar APN 1 72651727 missense probably benign 0.40
IGL01885:Ankar APN 1 72658703 missense probably damaging 1.00
IGL01932:Ankar APN 1 72698987 missense probably benign 0.25
IGL02143:Ankar APN 1 72658649 critical splice donor site probably null
IGL02326:Ankar APN 1 72666355 missense probably damaging 1.00
IGL02445:Ankar APN 1 72666365 missense probably benign 0.05
IGL02606:Ankar APN 1 72690285 missense possibly damaging 0.61
IGL02635:Ankar APN 1 72652431 missense possibly damaging 0.93
IGL02680:Ankar APN 1 72670116 missense probably damaging 1.00
IGL02704:Ankar APN 1 72652343 missense possibly damaging 0.88
IGL03086:Ankar APN 1 72643278 missense possibly damaging 0.84
IGL03269:Ankar APN 1 72665201 missense probably damaging 0.99
IGL03368:Ankar APN 1 72675813 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0488:Ankar UTSW 1 72658732 missense probably damaging 1.00
R0650:Ankar UTSW 1 72656221 splice site probably benign
R1121:Ankar UTSW 1 72651663 splice site probably null
R1163:Ankar UTSW 1 72688705 missense possibly damaging 0.82
R1300:Ankar UTSW 1 72643164 missense probably benign 0.00
R1309:Ankar UTSW 1 72674004 missense possibly damaging 0.59
R1366:Ankar UTSW 1 72698649 missense probably damaging 1.00
R1456:Ankar UTSW 1 72665118 missense probably benign 0.34
R1495:Ankar UTSW 1 72643291 missense probably benign
R1583:Ankar UTSW 1 72679555 splice site probably benign
R1635:Ankar UTSW 1 72650138 missense probably damaging 0.99
R1975:Ankar UTSW 1 72658441 missense possibly damaging 0.95
R2036:Ankar UTSW 1 72666530 nonsense probably null
R2511:Ankar UTSW 1 72658694 missense probably damaging 1.00
R2965:Ankar UTSW 1 72675820 missense probably benign 0.00
R3404:Ankar UTSW 1 72643093 nonsense probably null
R3417:Ankar UTSW 1 72658976 critical splice donor site probably null
R4072:Ankar UTSW 1 72688592 missense probably damaging 1.00
R4231:Ankar UTSW 1 72658542 missense probably benign 0.23
R4447:Ankar UTSW 1 72687789 missense possibly damaging 0.60
R4632:Ankar UTSW 1 72647184 missense probably benign 0.01
R4720:Ankar UTSW 1 72699011 missense possibly damaging 0.55
R4754:Ankar UTSW 1 72698694 missense probably damaging 1.00
R4884:Ankar UTSW 1 72698807 missense probably damaging 0.97
R5068:Ankar UTSW 1 72680210 splice site probably null
R5069:Ankar UTSW 1 72680210 splice site probably null
R5070:Ankar UTSW 1 72680210 splice site probably null
R5189:Ankar UTSW 1 72658414 missense probably benign 0.01
R5247:Ankar UTSW 1 72680184 missense probably benign 0.08
R5322:Ankar UTSW 1 72690386 splice site probably null
R5345:Ankar UTSW 1 72670151 missense possibly damaging 0.94
R5864:Ankar UTSW 1 72659165 missense probably benign 0.00
R5976:Ankar UTSW 1 72643291 missense probably benign
R6003:Ankar UTSW 1 72698887 missense probably damaging 1.00
R6042:Ankar UTSW 1 72674054 nonsense probably null
R6296:Ankar UTSW 1 72643258 missense probably damaging 1.00
R6488:Ankar UTSW 1 72681808 critical splice donor site probably null
R6885:Ankar UTSW 1 72643036 missense unknown
R6985:Ankar UTSW 1 72658482 missense probably damaging 1.00
R7060:Ankar UTSW 1 72656113 missense probably benign 0.18
R7099:Ankar UTSW 1 72643293 missense probably damaging 0.99
R7194:Ankar UTSW 1 72659033 missense probably benign 0.32
R7221:Ankar UTSW 1 72650231 missense probably damaging 1.00
R7222:Ankar UTSW 1 72666355 missense probably damaging 0.99
R7258:Ankar UTSW 1 72651727 missense probably benign 0.40
R7303:Ankar UTSW 1 72659033 missense probably benign 0.32
R7308:Ankar UTSW 1 72651794 nonsense probably null
R7384:Ankar UTSW 1 72658465 missense probably benign 0.00
R7424:Ankar UTSW 1 72680058 missense probably damaging 1.00
R7464:Ankar UTSW 1 72698894 missense possibly damaging 0.94
R7525:Ankar UTSW 1 72688641 missense probably benign 0.18
R7618:Ankar UTSW 1 72675766 missense probably benign 0.22
R7659:Ankar UTSW 1 72690135 missense possibly damaging 0.95
R7974:Ankar UTSW 1 72698979 nonsense probably null
R8008:Ankar UTSW 1 72666484 missense possibly damaging 0.47
R8119:Ankar UTSW 1 72647001 missense probably damaging 0.98
R8244:Ankar UTSW 1 72651024 missense probably benign
R8342:Ankar UTSW 1 72652460 missense probably damaging 1.00
R8494:Ankar UTSW 1 72658794 missense probably benign 0.16
R8970:Ankar UTSW 1 72652337 critical splice donor site probably null
R9228:Ankar UTSW 1 72674051 missense probably benign 0.27
R9511:Ankar UTSW 1 72680002 missense probably benign 0.23
R9577:Ankar UTSW 1 72681908 missense probably benign 0.02
R9612:Ankar UTSW 1 72665135 missense possibly damaging 0.65
R9647:Ankar UTSW 1 72650148 missense probably damaging 1.00
R9803:Ankar UTSW 1 72659181 missense possibly damaging 0.47
Z1176:Ankar UTSW 1 72689961 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCCTGTCTTCCTTGGAAAATTTG -3'
(R):5'- CCTGCAGAAGCTGTGTTAGTC -3'

Sequencing Primer
(F):5'- TCATGACCTACAAAGAGACATTTTG -3'
(R):5'- ACCATGCTTTAAAACCCTTTATAACC -3'
Posted On 2021-07-15