Incidental Mutation 'R8871:Mllt3'
ID 676267
Institutional Source Beutler Lab
Gene Symbol Mllt3
Ensembl Gene ENSMUSG00000028496
Gene Name myeloid/lymphoid or mixed-lineage leukemia; translocated to, 3
Synonyms Af9, D4Ertd321e, 2610012I03Rik, 3830408D16Rik, 2210011H10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8871 (G1)
Quality Score 103.467
Status Not validated
Chromosome 4
Chromosomal Location 87769925-88033364 bp(-) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) ACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT to ACTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT at 87841315 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078090] [ENSMUST00000142454]
AlphaFold A2AM29
Predicted Effect probably benign
Transcript: ENSMUST00000078090
SMART Domains Protein: ENSMUSP00000077232
Gene: ENSMUSG00000028496

DomainStartEndE-ValueType
Pfam:YEATS 29 110 2.3e-29 PFAM
SCOP:d1l9ha_ 126 173 9e-3 SMART
internal_repeat_1 195 214 9.17e-5 PROSPERO
internal_repeat_1 206 225 9.17e-5 PROSPERO
low complexity region 226 246 N/A INTRINSIC
low complexity region 291 314 N/A INTRINSIC
SCOP:d1qbkb_ 315 467 7e-4 SMART
PDB:2LM0|A 485 569 3e-48 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000142454
SMART Domains Protein: ENSMUSP00000127376
Gene: ENSMUSG00000028496

DomainStartEndE-ValueType
Pfam:YEATS 26 66 2.6e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency 99% (76/77)
MGI Phenotype PHENOTYPE: About 50% of homozygous null mice die perinatally while the remaining 50% become runted and die within two weeks of birth with severe defects of the axial skeleton, including anterior homeotic transformation of the cervical and thoracic regions, a deformed atlas and an extra cervical vertebra. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T G 11: 9,298,071 M2606R probably benign Het
Abcg5 C T 17: 84,682,867 E3K probably benign Het
Adam20 A C 8: 40,795,564 H237P probably damaging Het
Alg3 T C 16: 20,605,934 Y361C probably damaging Het
Ano8 A T 8: 71,479,300 Y752N probably benign Het
AW551984 A T 9: 39,589,702 L759* probably null Het
Bdp1 A C 13: 100,049,667 V1759G probably damaging Het
Bicdl2 C A 17: 23,666,803 Q273K probably damaging Het
Cc2d2a A T 5: 43,699,943 T491S possibly damaging Het
Cdkl2 A G 5: 92,017,130 S545P possibly damaging Het
Ceacam5 T A 7: 17,760,902 I945K probably benign Het
Celf1 A G 2: 91,010,495 Y369C probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Col14a1 T G 15: 55,382,562 D487E unknown Het
Crybg3 T C 16: 59,558,156 N912D probably benign Het
Cstl1 A G 2: 148,754,634 T86A probably damaging Het
Dixdc1 C T 9: 50,683,796 V482M possibly damaging Het
Dmbt1 T C 7: 131,116,868 Y1773H unknown Het
Dock4 T C 12: 40,745,731 I849T probably benign Het
Fbln2 A T 6: 91,256,233 probably null Het
Fbxo16 A G 14: 65,293,899 E84G probably damaging Het
Fras1 T A 5: 96,707,398 V1922D probably benign Het
G6pc3 A G 11: 102,192,070 H85R probably damaging Het
Galc A T 12: 98,246,284 N197K probably damaging Het
Galnt12 T G 4: 47,108,582 probably null Het
Gm10220 T A 5: 26,117,865 Q183L probably benign Het
Gxylt2 A G 6: 100,783,148 T215A probably damaging Het
Hnrnpf T G 6: 117,923,850 S32A probably benign Het
Hspa1l T C 17: 34,978,823 Y613H probably benign Het
Il1r2 T A 1: 40,105,264 V37D probably benign Het
Itga11 C A 9: 62,761,541 Y693* probably null Het
Itgax T A 7: 128,136,051 F459L probably damaging Het
Jph1 A G 1: 16,997,495 V656A possibly damaging Het
Kcnn4 A T 7: 24,384,075 I394F possibly damaging Het
Kdelr3 T A 15: 79,525,843 Y176* probably null Het
Kif13a T C 13: 46,830,803 D162G probably damaging Het
Klhdc8b G A 9: 108,449,672 P164S probably damaging Het
Lmbrd1 A T 1: 24,744,354 Q357L probably damaging Het
Lrrc37a T C 11: 103,456,549 M3107V unknown Het
Muc16 C A 9: 18,656,048 G1725V unknown Het
Myo5c T C 9: 75,278,303 S983P probably benign Het
Naip1 G A 13: 100,443,638 H217Y probably damaging Het
Nlrc3 T C 16: 3,964,104 probably benign Het
Nrl A T 14: 55,520,727 L181Q probably damaging Het
Olfr1062 T C 2: 86,423,353 M108V probably benign Het
Olfr168 T C 16: 19,530,786 I45V Het
Olfr358 T C 2: 37,005,048 T189A probably benign Het
Olig1 T C 16: 91,270,657 *261R probably null Het
Oscp1 T A 4: 126,058,742 L21Q probably damaging Het
Oxct1 G A 15: 4,035,281 V34I probably benign Het
Pdzph1 A G 17: 58,888,038 L1074P probably damaging Het
Pkd1l1 T A 11: 8,950,503 S463C Het
Pnpla3 G A 15: 84,179,308 E296K probably benign Het
Prss35 T G 9: 86,755,191 L5V possibly damaging Het
Rbck1 T C 2: 152,322,176 E336G possibly damaging Het
Rgl2 G A 17: 33,935,000 R460Q probably damaging Het
Rmi1 T A 13: 58,409,342 N468K probably benign Het
Rptor T A 11: 119,603,925 I39N probably benign Het
S1pr1 A G 3: 115,711,979 F322S probably damaging Het
Scgb1b10 T A 7: 32,101,119 Y44* probably null Het
Setx A G 2: 29,148,102 D1533G probably benign Het
Sf3b1 A G 1: 54,990,349 Y1165H probably damaging Het
Sgcz A T 8: 37,952,949 Y50N probably damaging Het
Sh3gl2 C A 4: 85,387,580 P227Q Het
She T C 3: 89,852,488 probably null Het
Slc9a4 T C 1: 40,602,855 I328T probably damaging Het
Sort1 G A 3: 108,355,571 probably null Het
Srebf1 A G 11: 60,200,769 S977P probably benign Het
Srsf9 T C 5: 115,330,653 V116A probably damaging Het
Tex15 G A 8: 33,576,964 V2141I possibly damaging Het
Tmprss13 A T 9: 45,338,406 H347L probably damaging Het
Trpv4 A G 5: 114,630,450 F519S probably benign Het
Trrap A G 5: 144,821,839 T2159A probably benign Het
Vmn1r36 A T 6: 66,716,458 Y144* probably null Het
Vmn2r10 A G 5: 108,999,033 I463T possibly damaging Het
Vps13a T A 19: 16,663,822 N2312I probably damaging Het
Wdr81 A T 11: 75,453,093 Y449* probably null Het
Zfhx3 A G 8: 108,950,235 D2639G possibly damaging Het
Zfp120 A G 2: 150,118,075 V131A probably benign Het
Zfp574 G T 7: 25,081,137 C528F probably damaging Het
Zfp947 A T 17: 22,145,714 N326K probably benign Het
Other mutations in Mllt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Mllt3 APN 4 87791881 missense probably benign 0.00
IGL01078:Mllt3 APN 4 87880060 splice site probably benign
IGL01337:Mllt3 APN 4 87840820 missense probably damaging 0.99
IGL02664:Mllt3 APN 4 88031623 missense probably damaging 1.00
PIT4504001:Mllt3 UTSW 4 87774087 missense probably damaging 1.00
R0226:Mllt3 UTSW 4 87840732 missense probably benign 0.00
R0415:Mllt3 UTSW 4 87841339 utr 3 prime probably benign
R0540:Mllt3 UTSW 4 87841044 missense possibly damaging 0.73
R0618:Mllt3 UTSW 4 87841267 utr 3 prime probably benign
R0932:Mllt3 UTSW 4 87789384 missense probably damaging 0.99
R1713:Mllt3 UTSW 4 87783664 missense probably damaging 1.00
R4748:Mllt3 UTSW 4 87840781 missense possibly damaging 0.60
R4928:Mllt3 UTSW 4 87782405 splice site probably null
R5086:Mllt3 UTSW 4 87789298 missense probably damaging 0.99
R5186:Mllt3 UTSW 4 87840995 missense probably benign 0.00
R5359:Mllt3 UTSW 4 87840927 missense probably benign 0.21
R5371:Mllt3 UTSW 4 87840856 missense possibly damaging 0.64
R5713:Mllt3 UTSW 4 87841211 missense probably benign 0.01
R5787:Mllt3 UTSW 4 87840820 missense probably damaging 0.99
R6346:Mllt3 UTSW 4 87841208 missense probably damaging 1.00
R6462:Mllt3 UTSW 4 87774101 missense probably damaging 1.00
R6621:Mllt3 UTSW 4 87840797 missense possibly damaging 0.66
R6629:Mllt3 UTSW 4 87841267 utr 3 prime probably benign
R7380:Mllt3 UTSW 4 87791943 missense possibly damaging 0.85
R7600:Mllt3 UTSW 4 87841219 missense probably benign 0.07
R8045:Mllt3 UTSW 4 87841113 missense probably damaging 1.00
R9281:Mllt3 UTSW 4 87789329 missense probably benign 0.12
R9300:Mllt3 UTSW 4 87774047 nonsense probably null
R9341:Mllt3 UTSW 4 87873931 missense possibly damaging 0.46
R9343:Mllt3 UTSW 4 87873931 missense possibly damaging 0.46
R9544:Mllt3 UTSW 4 87841181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTGGAAGGTTCTTTGAAG -3'
(R):5'- CTTGTTGGTGAAGGCCCATG -3'

Sequencing Primer
(F):5'- AGGCACTTTTATGTTCTCTGGAGTCC -3'
(R):5'- GAAATAATCTTATGGTTGGGGCCACC -3'
Posted On 2021-07-15