Incidental Mutation 'R9151:Olfr1444'
ID 695070
Institutional Source Beutler Lab
Gene Symbol Olfr1444
Ensembl Gene ENSMUSG00000046272
Gene Name olfactory receptor 1444
Synonyms MOR202-4, GA_x6K02T2RE5P-3191201-3192160
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock # R9151 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 12857283-12863440 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12862612 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 279 (Y279C)
Ref Sequence ENSEMBL: ENSMUSP00000150212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059675] [ENSMUST00000213606]
AlphaFold Q8VFX2
Predicted Effect probably damaging
Transcript: ENSMUST00000059675
AA Change: Y279C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062460
Gene: ENSMUSG00000046272
AA Change: Y279C

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 1.6e-54 PFAM
Pfam:7tm_1 42 291 5.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213606
AA Change: Y279C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,285,094 H4027Q probably damaging Het
Abca5 A G 11: 110,298,082 F850L probably benign Het
Adam1a A T 5: 121,519,348 D627E probably damaging Het
Add2 C A 6: 86,104,477 probably benign Het
Anpep T C 7: 79,842,037 N72S probably benign Het
Aqp6 A G 15: 99,603,774 T238A possibly damaging Het
Arhgef38 G T 3: 133,206,945 T111K Het
Atg10 A G 13: 91,040,913 Y93H probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Cald1 A G 6: 34,755,747 N286S unknown Het
Caps2 A T 10: 112,195,924 I322F possibly damaging Het
Cbx3 T A 6: 51,478,553 S95T probably benign Het
Ccdc24 T C 4: 117,869,905 T83A unknown Het
Cntn1 T C 15: 92,242,983 Y197H probably damaging Het
Cpd A G 11: 76,784,449 I1282T possibly damaging Het
Crat A T 2: 30,405,040 S454R probably damaging Het
D2hgdh G A 1: 93,826,616 V126I probably benign Het
Dcst1 A G 3: 89,364,251 V75A probably benign Het
Dnm1l T C 16: 16,358,804 D21G probably benign Het
Evc2 A G 5: 37,347,479 N74D probably benign Het
Gm19965 A T 1: 116,821,212 M208L Het
Gm6205 A G 5: 94,683,977 Y281C possibly damaging Het
Gprc6a T G 10: 51,621,086 T454P possibly damaging Het
Gprin1 C T 13: 54,738,965 V499M probably benign Het
Gtf3c5 A G 2: 28,573,565 Y194H probably damaging Het
Hcn4 T C 9: 58,860,597 V1147A possibly damaging Het
Ighv1-82 A C 12: 115,952,722 V56G probably damaging Het
Ins2 T C 7: 142,678,768 D93G possibly damaging Het
Itgb8 A G 12: 119,166,800 S658P probably benign Het
Kcnmb1 T C 11: 33,970,263 F159L probably benign Het
Klf1 C T 8: 84,903,325 L260F probably benign Het
Larp4 T A 15: 99,990,324 S140T possibly damaging Het
Maneal C A 4: 124,861,749 R140L probably benign Het
Mfsd11 T A 11: 116,859,497 V114D Het
Muc4 A G 16: 32,752,617 T832A probably benign Het
Myh11 T G 16: 14,232,575 I509L Het
Myh13 A T 11: 67,361,323 E1419V probably damaging Het
Myh7b A G 2: 155,632,519 E1718G probably damaging Het
Myo9b T A 8: 71,355,227 probably benign Het
Notch1 A T 2: 26,477,927 L656Q probably benign Het
Nova1 A G 12: 46,700,030 I488T probably damaging Het
Olfr1467 A T 19: 13,364,858 T77S possibly damaging Het
Olfr213 A T 6: 116,541,029 N192I possibly damaging Het
Olfr550 A T 7: 102,579,293 E266V probably damaging Het
Olfr73 A G 2: 88,034,353 V262A probably damaging Het
Olfr781 A G 10: 129,333,754 N291S probably damaging Het
Pax6 C T 2: 105,692,752 S325L probably benign Het
Phldb1 T C 9: 44,708,443 D142G probably null Het
Phldb3 T G 7: 24,624,623 probably benign Het
Pikfyve G T 1: 65,196,739 R190L probably damaging Het
Plagl2 A T 2: 153,232,620 H120Q probably damaging Het
Pou2f1 A T 1: 165,876,071 probably benign Het
Prpf6 A G 2: 181,608,208 R54G possibly damaging Het
Prss33 T C 17: 23,833,992 E236G probably benign Het
Ptpru T C 4: 131,794,967 Y709C probably benign Het
Rcc1l A G 5: 134,168,218 V212A probably benign Het
Rtl1 G A 12: 109,593,573 L611F Het
Scp2 A G 4: 108,074,406 I344T possibly damaging Het
Serpinb2 A T 1: 107,522,160 D101V possibly damaging Het
Slc13a1 T C 6: 24,097,663 T422A probably damaging Het
Slc38a10 G T 11: 120,116,936 T406K probably benign Het
Smad4 T C 18: 73,649,735 E376G probably damaging Het
Smarcb1 T C 10: 75,915,082 E115G probably benign Het
Taf5 G A 19: 47,074,931 V307I probably damaging Het
Tnc T C 4: 64,020,449 N51S possibly damaging Het
Trp53inp2 G T 2: 155,386,638 R171L possibly damaging Het
Ttc13 A T 8: 124,675,282 D579E probably benign Het
Ttn A T 2: 76,945,552 N1761K unknown Het
Ttpa C T 4: 20,008,401 probably benign Het
Ugt3a2 G A 15: 9,361,965 V276I probably benign Het
Usp4 T A 9: 108,366,812 H296Q probably benign Het
Vmn1r119 T A 7: 21,011,668 H263L possibly damaging Het
Vmn2r81 A G 10: 79,268,071 D176G Het
Wdr1 A T 5: 38,530,125 probably benign Het
Zfp488 T G 14: 33,970,738 Q156P possibly damaging Het
Other mutations in Olfr1444
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Olfr1444 APN 19 12861867 missense probably benign 0.00
IGL01963:Olfr1444 APN 19 12862382 missense probably benign 0.00
IGL02030:Olfr1444 APN 19 12862435 missense probably benign 0.00
IGL02178:Olfr1444 APN 19 12862543 missense possibly damaging 0.49
IGL02641:Olfr1444 APN 19 12862202 nonsense probably null
R0311:Olfr1444 UTSW 19 12861869 missense probably benign 0.01
R0543:Olfr1444 UTSW 19 12861888 missense probably benign 0.00
R0815:Olfr1444 UTSW 19 12862644 missense probably benign 0.00
R2034:Olfr1444 UTSW 19 12861787 missense possibly damaging 0.82
R2078:Olfr1444 UTSW 19 12862387 missense probably benign 0.05
R2431:Olfr1444 UTSW 19 12862606 missense probably damaging 1.00
R3032:Olfr1444 UTSW 19 12861918 missense probably benign 0.00
R3932:Olfr1444 UTSW 19 12862630 missense possibly damaging 0.95
R4498:Olfr1444 UTSW 19 12862669 missense probably damaging 1.00
R4654:Olfr1444 UTSW 19 12862232 nonsense probably null
R4708:Olfr1444 UTSW 19 12861897 missense probably benign 0.00
R4823:Olfr1444 UTSW 19 12861816 missense probably benign 0.04
R4938:Olfr1444 UTSW 19 12862552 missense probably damaging 1.00
R4980:Olfr1444 UTSW 19 12862020 missense probably benign
R5580:Olfr1444 UTSW 19 12861804 missense possibly damaging 0.59
R5622:Olfr1444 UTSW 19 12862299 missense probably benign 0.08
R5671:Olfr1444 UTSW 19 12861807 missense probably benign 0.02
R6149:Olfr1444 UTSW 19 12862359 missense probably benign 0.02
R6683:Olfr1444 UTSW 19 12862650 missense probably damaging 0.98
R7389:Olfr1444 UTSW 19 12862617 missense probably benign 0.04
R7392:Olfr1444 UTSW 19 12862587 missense probably benign 0.18
R7461:Olfr1444 UTSW 19 12861777 start codon destroyed probably benign 0.00
R7613:Olfr1444 UTSW 19 12861777 start codon destroyed probably benign 0.00
R7698:Olfr1444 UTSW 19 12862713 missense possibly damaging 0.69
R7717:Olfr1444 UTSW 19 12861795 missense probably benign 0.07
R7892:Olfr1444 UTSW 19 12862479 nonsense probably null
R9656:Olfr1444 UTSW 19 12861883 missense probably damaging 1.00
Z1088:Olfr1444 UTSW 19 12862284 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAATCCATGCTGCAGATAC -3'
(R):5'- AAAAGTTGCATTGCCCAGGAG -3'

Sequencing Primer
(F):5'- GCACACACATCAGTAAATTGGTTGTC -3'
(R):5'- AGGAGGCGATCTATCCCTTAC -3'
Posted On 2022-01-20