Incidental Mutation 'R9455:Mep1a'
ID 714560
Institutional Source Beutler Lab
Gene Symbol Mep1a
Ensembl Gene ENSMUSG00000023914
Gene Name meprin 1 alpha
Synonyms Mep-1a, meprin A alpha-subunit, Mep1, meprin alpha, Mep-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9455 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 43474324-43502812 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43494976 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 100 (E100G)
Ref Sequence ENSEMBL: ENSMUSP00000024707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024707] [ENSMUST00000117137]
AlphaFold P28825
Predicted Effect probably benign
Transcript: ENSMUST00000024707
AA Change: E100G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000024707
Gene: ENSMUSG00000023914
AA Change: E100G

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
ZnMc 83 222 1.16e-41 SMART
MAM 276 445 5.38e-61 SMART
MATH 445 590 6.9e-17 SMART
EGF 687 724 1.35e-2 SMART
transmembrane domain 727 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117137
AA Change: E87G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113838
Gene: ENSMUSG00000023914
AA Change: E87G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
ZnMc 70 209 1.16e-41 SMART
MAM 263 432 5.38e-61 SMART
MATH 432 577 6.9e-17 SMART
EGF 674 711 1.35e-2 SMART
transmembrane domain 714 736 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased litter size, reduced LPS-induced renal injury and bladder inflammation, and increased susceptibility to sodium dextran sulfate-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,403,897 Y3740H probably damaging Het
Acsl6 G T 11: 54,319,926 probably benign Het
Adamts5 C T 16: 85,870,129 D492N probably damaging Het
Als2 T C 1: 59,180,137 E1218G probably damaging Het
BC055324 G T 1: 163,954,152 T902K probably benign Het
Bcl2l15 C T 3: 103,836,053 T90I unknown Het
Bsn A G 9: 108,111,332 V2407A unknown Het
Casp8ap2 T C 4: 32,643,924 M999T possibly damaging Het
Ccdc66 G A 14: 27,486,915 P461S probably benign Het
Cd46 G A 1: 195,062,396 L345F possibly damaging Het
Cep295 A T 9: 15,333,750 S1137T possibly damaging Het
Chd7 A G 4: 8,752,061 Y186C unknown Het
Clca3b T A 3: 144,823,262 T884S unknown Het
Cndp2 T A 18: 84,672,121 Y232F probably benign Het
Cx3cr1 A T 9: 120,051,593 Y248N probably damaging Het
Dnm3 A T 1: 162,320,955 N282K possibly damaging Het
Emilin2 T C 17: 71,274,490 I414V probably benign Het
F3 A T 3: 121,734,217 N288I probably damaging Het
Fat4 T C 3: 38,891,263 L1435P Het
Fbxw14 A T 9: 109,274,499 N371K probably benign Het
Fn1 T A 1: 71,607,953 E1559D probably benign Het
Frrs1 T A 3: 116,902,323 M497K possibly damaging Het
Gm45861 C T 8: 27,551,366 Q1000* probably null Het
Gm5415 A T 1: 32,546,826 M1K probably null Het
Gpr152 T C 19: 4,143,845 S462P probably benign Het
Irgq A G 7: 24,531,792 N136S probably benign Het
Kdm2b T C 5: 122,961,474 Y134C probably damaging Het
Klf12 A T 14: 100,109,790 L35H probably damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Ksr1 A T 11: 79,020,776 C727S possibly damaging Het
Lpin3 G T 2: 160,895,339 R102L probably benign Het
Ltv1 T C 10: 13,182,373 E229G probably damaging Het
Ly6f T A 15: 75,269,799 Y30* probably null Het
Map2k7 C G 8: 4,243,957 R168G probably damaging Het
Mrgpra6 T A 7: 47,189,219 Y46F probably damaging Het
Mroh6 C A 15: 75,888,056 R143L probably benign Het
Myom2 T A 8: 15,106,293 H713Q probably benign Het
Ndn C T 7: 62,348,589 P61L possibly damaging Het
Olfr65 G T 7: 103,906,993 V182F Het
Pear1 T A 3: 87,759,181 T72S possibly damaging Het
Sel1l3 T A 5: 53,131,815 N888I probably damaging Het
Sell A T 1: 164,066,649 T171S probably benign Het
Sin3b G T 8: 72,724,053 A37S possibly damaging Het
Sipa1l1 T C 12: 82,387,625 F723S probably damaging Het
Slc26a8 T C 17: 28,644,614 T724A probably damaging Het
Slc51a T G 16: 32,486,195 N25H probably damaging Het
Slc9a4 T C 1: 40,629,452 F752L probably benign Het
Slco4a1 A C 2: 180,473,577 D649A probably benign Het
Tax1bp1 T A 6: 52,766,044 H805Q probably damaging Het
Tgfb1i1 T C 7: 128,252,837 F303L probably damaging Het
Tsg101 A T 7: 46,913,403 D34E probably damaging Het
Tspoap1 T C 11: 87,770,533 S604P probably damaging Het
Ttll2 C A 17: 7,352,293 W78C probably damaging Het
Ttn A G 2: 76,918,990 F3905S possibly damaging Het
Txnrd2 G T 16: 18,429,865 C57F probably damaging Het
Vcan A T 13: 89,689,333 D2697E probably damaging Het
Vwa8 G A 14: 79,062,675 V983I probably damaging Het
Other mutations in Mep1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Mep1a APN 17 43479084 missense probably benign 0.00
IGL02814:Mep1a APN 17 43477221 missense probably benign
IGL03000:Mep1a APN 17 43474990 missense probably benign
IGL03335:Mep1a APN 17 43477173 missense possibly damaging 0.63
IGL03410:Mep1a APN 17 43478095 splice site probably null
PIT4544001:Mep1a UTSW 17 43482287 missense probably damaging 1.00
R0127:Mep1a UTSW 17 43497886 splice site probably benign
R0306:Mep1a UTSW 17 43502643 splice site probably benign
R0329:Mep1a UTSW 17 43497898 critical splice donor site probably null
R0330:Mep1a UTSW 17 43497898 critical splice donor site probably null
R0358:Mep1a UTSW 17 43478950 missense possibly damaging 0.92
R0667:Mep1a UTSW 17 43478190 missense probably benign 0.06
R1101:Mep1a UTSW 17 43491693 missense probably benign 0.03
R1458:Mep1a UTSW 17 43491672 missense probably damaging 1.00
R1525:Mep1a UTSW 17 43491636 missense probably damaging 1.00
R1992:Mep1a UTSW 17 43502682 missense probably benign
R2014:Mep1a UTSW 17 43497906 missense probably benign 0.01
R2212:Mep1a UTSW 17 43477263 missense probably benign 0.02
R3946:Mep1a UTSW 17 43475041 nonsense probably null
R4400:Mep1a UTSW 17 43475006 missense possibly damaging 0.77
R4598:Mep1a UTSW 17 43491578 critical splice donor site probably null
R4616:Mep1a UTSW 17 43486241 missense possibly damaging 0.81
R4688:Mep1a UTSW 17 43482248 missense possibly damaging 0.89
R5085:Mep1a UTSW 17 43478144 missense probably damaging 0.99
R5355:Mep1a UTSW 17 43477146 missense probably damaging 0.98
R5832:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5833:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5834:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5835:Mep1a UTSW 17 43478164 missense probably benign 0.27
R6280:Mep1a UTSW 17 43502392 missense probably damaging 1.00
R6340:Mep1a UTSW 17 43479058 missense probably benign 0.00
R6340:Mep1a UTSW 17 43479233 missense probably benign 0.00
R6934:Mep1a UTSW 17 43482230 missense probably damaging 0.99
R7247:Mep1a UTSW 17 43475104 missense possibly damaging 0.67
R7660:Mep1a UTSW 17 43478977 missense probably benign 0.29
R7685:Mep1a UTSW 17 43479174 missense probably benign 0.00
R7703:Mep1a UTSW 17 43478106 missense possibly damaging 0.69
R7871:Mep1a UTSW 17 43479235 missense probably benign 0.33
R8131:Mep1a UTSW 17 43502667 missense probably benign 0.00
R8783:Mep1a UTSW 17 43478190 missense probably benign 0.00
R8880:Mep1a UTSW 17 43497917 missense possibly damaging 0.46
R9448:Mep1a UTSW 17 43494978 critical splice acceptor site probably null
RF010:Mep1a UTSW 17 43486235 missense probably damaging 0.99
Z1088:Mep1a UTSW 17 43491596 missense probably damaging 1.00
Z1176:Mep1a UTSW 17 43477320 missense probably benign 0.08
Z1177:Mep1a UTSW 17 43486297 missense probably damaging 1.00
Z1177:Mep1a UTSW 17 43486306 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGAGACTGCAAAGATAGCTCAAG -3'
(R):5'- TTCCTCTTGCAACCCTGAGG -3'

Sequencing Primer
(F):5'- CTCAAGAGCTAAGACTTGCTTTTG -3'
(R):5'- ACGGTCAGTCCTCTGTAT -3'
Posted On 2022-06-15